Saved in:
| Main Authors: | , , , , , , , |
|---|---|
| Format: | Recurso digital |
| Sprog: | |
| Udgivet: |
Zenodo
2025
|
| Fag: | |
| Online adgang: | https://doi.org/10.5281/zenodo.18312815 |
| Tags: |
Tilføj Tag
Ingen Tags, Vær først til at tagge denne postø!
|
Indholdsfortegnelse:
- <p><i>Neoempheria sinkapho</i> Amorim & Oliveira sp. n.</p><p>(Fig. 67A–D)</p><p>https://singapore.biodiversity.online/species/A-Arth-Hexa-Diptera-00788</p><p>urn:lsid:zoobank.org:act: 2A828E5D-53FF-4CFD-9B4D-EC75F753B0BE</p><p><b>Diagnosis</b></p><p>Scutum with five longitudinal brown stripes, a brownish line over dorsal half of mediotergite extending to dorsal third of laterotergite. Wing with a brown mark across tip of wing, a second, light brown mark across wing between level of sc-r and anal lobe through level of origin of M 4, with an additional dark brown mark over R 4. C extending beyond tip of R 5 for a 1/4 of distance to M 1; sc-r at basal third of cell r1; anterior margin of cell r1 slightly less than 3× length of R 4. Abdominal tergites 1–2 and 7 cream-yellow with a caramel-brown transverse mark along posterior margin; tergites 3–4 and 6 cream-yellow with brown marks extending medially to the anterior margin and a slender brown mark along lateral margin; tergite 5 mostly caramel-brown with a large cream-yellow mark on lateroanterior corners. Gonocoxites with a dorsal setose extension reaching beyond tip of gonostylus; gonostylus small, flat, with a short outer lobe near tip; aedeagus with a medial crest with a row of spines; parameres with a line of short spines medially at posterior margin; tergite 9 with a pair of posterior setose lobes.</p><p><i>Neoempheria_sinkapho _ ZRCBDP 0047884_hapZRCBDP0047884_SMH_holotype</i> [46: A, 55: A, 70: G, 130: C, 134: G, 147: A, 261: G, 274: C] tttatcttcaactattgctcatac aggagcttctgttgatttagcAattttttcAttacatttagctggGatttcttctatttt aggagctgttaattttattacaacaatcattaatatacgagctccCggaGtacaatt tgataAaatacctttatttgtatgatctgtattaattacagcaattttattattattatcatt accagtattagctggagctattacaatattactaacagatcgaaatttaaatacaaG attctttgacccCgcaggtggaggagaccctattctttaccaacatttattt</p><p><b>Description</b></p><p>Male (Fig. 67A). Wing length, 3.34; width, 1.31. Head. Ochre background, with a brownish band running from dorsal end of eye towards mid of vertex and a dark brown medial band above base of antennae. Face brownish, clypeus light brown. Antennal scape and pedicel brown, flagellum dark brown (Fig. 67B). Maxillary palpus brown, last palpomere lighter, labella whitish. No post-ocellar setae, no setae on frons anteriorly to line of ocelli. Scape 1.4× length of pedicel, flagellomere 1 1.5× flagellomere 2 length, flagellomere 4 0.7× longer than wide. Palpomere 4 1.1× palpomere 3 length, palpomere 5 1.7× palpomere 4 length. Thorax. Scutum ochre-yellow, a pair of brown stripes along dorsocentral lines, a slender light brown medial band, an additional pair of brownish bands along laterals; scutellum ochre-yellow with a brownish tinge medially. Pleural sclerites whitish with an orangish tinge, except for a brown mark anteriorly on antepronotum lobes, a brown mark on laterotergite dorsoposterior end, and a brown band along dorsal half of mediotergite. Scutum with a pair of strong prescutellar setae on dorsocentral line and two pairs of stronger prescutellar setae on lateroposterior corner; one pair of scutellar strong setae, besides an irregular row of small setae more anteriorly. Antepronotum with one bristle and some other large and some small setae, proepisternum bare. Halter pedicel ochre-yellow, knob light brown. Legs. Coxae whitish, fore femur whitish-yellow, mid and hind femur ochre-yellow, tibiae and tarsi light greyish-brown. Hind tibia inner spur 3.5× longer than tibia width at apex. Wing (Fig. 67C). Membrane background light greyish-brown, with brown marks over sc-r, first sector of Rs, R 4, and base of M 4, and a large greyish-brown macula on distal third of wing, beginning at base of medial fork. C produced beyond tip of R 5 for about a fifth of distance to M 1. Sc complete, reaching C almost at mid of cell r1; R 4 present, transverse, far from origin of Rs, anterior margin of cell r1 3.2× length of R 4; first sector of Rs 1.0× r-m length. False medial vein present, hardly sclerotized. M 1+2 3.3× r-m length; bM 7.7× length of first sector of Rs. First sector of CuA 0.90× longer than second sector. M 4 gently depressed on distal half. Cubital pseudovein sclerotized to distal fourth of CuA; CuA unsclerotized at very tip; CuP sclerotized to basal third of second sector of CuA. Wing margin gently emarginated at tip of CuA. No macrotrichia on wing membrane, no ventral macrotrichia on veins, dorsal macrotrichia on distal 3/4 of Sc, entire length of bR, R 1, second sector of Rs, M 1, M 2, M 4, and CuA; sc-r, first sector of Rs, R 4, r-m, bM, M 2, M 4, and CuP devoid of macrotrichia. Abdomen. Tergites with light ochre-yellow background color, tergites 1–2 with a medial brown longitudinal mark, tergites 3–7 with medial brown mark extending laterally on posterior margin and a slender lateral band, tergite 5 mostly brown with medial and lateral brown bands connected, only anterolateral corners light ochre-yellow. Sternites 1–4 whitish-yellow, sternites 5–7 more yellowish. Terminalia (Fig. 67D). Whitish-yellow. Gonocoxites fused along a slender medial connection, no suture of fusion, short medio-posterior projection that extends dorsally, connecting to aedeagal sclerite, lateroposteriorly projecting only slightly beyond insertion of gonostylus. Gonostylus laterally at terminalia, a straight, bare inner lobe projecting posteriorly and a bifid outer lobe, ventral branch directed obliquely inward with some short setae on distal half, dorsal branch directed posteriorly covered with setae on external face. Gonocoxal bridge with a pair of long arms that project towards anterior end of terminalia, a pair of apodemes anteriorly close to each other. Aedeagal sclerite with anterior end slender, widening mid-way to apex, a pair of sub-medial short lobes, a pair of longer slender lobes projected obliquely inward reaching level of insertion of gonostylus. Paramere widening towards posterior third, then with a slender distal projection ending with a dorsoventral crest with a sequence of short teeth. Tergite 9 with a pair of long lobes connected medially, each lobe long, slendering towards apex, projecting way beyond tip of gonostylus, covered with long setae on dorsal face, a distal strong curved seta at tip of inner margin directed anteriorly. Sternite 10 triangular, with a group of five spines directed ventrally on distal end. Cerci slender, elongate.</p><p>Female. Unknown.</p><p>Material examined</p><p>Holotype: male, ZRCBDP 0047884, Nee Soon (NS2), swamp forest, 23.oct.13, MIP leg. (website photo specimen, slide-mounted).</p><p>Paratypes (2 males): ZRCBDP 0048809, Nee Soon (NS1), 14.jan.15, MIP leg. (extracted); ZRCBDP 0048955, Nee Soon (NS1), 15.apr.15, MIP leg.</p><p>Etymology</p><p>The specific epithet refers to the Chinese Hokkien dialect transcription of Singapore, Xin Jia Po [<b>Ĕ加®</b>]. Hokkien is one of the largest Chinese dialect groups in Singapore. The noun is used in apposition.</p><p><b>Remarks</b></p><p>This is another species of the <i>ferruginea</i> -group of <i>Neoempheria</i>, with specimens from the swamp forest. There are two haplotypes for <i>Neoempheria sinkapho</i> <b>sp. n.</b>, which are separated into two species only by objective clustering at 2% p-distance.</p>