qPCR before and after bleaching and after symbiont switing in the foraminifera Sorites orbiculus
Fuente:
PANGAEA
Guardado en:
| Autores principales: | , , , , , , , , |
|---|---|
| Formato: | Dataset Open Access |
| Lenguaje: | en |
| Publicado: |
PANGAEA
2026
|
| Materias: | |
| Acceso en línea: | |
| Etiquetas: |
Agregar Etiqueta
Sin Etiquetas, Sea el primero en etiquetar este registro!
|
| _version_ | 1867170441103147008 |
|---|---|
| author | Timme, Lukas Theodor Henschen, Helena Puerto Rueda, Diana N Manda, Sneha Parkinson, John Everett Wild, Christian Abramovich, Sigal Morard, Raphael Schmidt, Christiane |
| author_facet | Timme, Lukas Theodor Henschen, Helena Puerto Rueda, Diana N Manda, Sneha Parkinson, John Everett Wild, Christian Abramovich, Sigal Morard, Raphael Schmidt, Christiane |
| collection | Datos científicos de ciencias marinas y ambientales |
| contents | The uptake of novel Symbiodiniaceae strains in Sorites orbiculus was measured using qPCR. To facilitate novel algae uptake, the specimens were bleached for 27 days with 0.19 mmol L-1 menthol and 5 µmol L-1 DCMU, followed by 19 days of re-inoculation with the Symbiodinium microadriaticum (strains KB8 and CCMP2467) and Fugacium kawagutii (strain F2) individually and collectively at a concentration of 1e5 cells ml-1 and a further observation for 37 days to verify long-term establishment of symbiosis. The primer pairs S.S.ITS2F (5′- TTCTGCTGCTCTTGTTATCAGG− 3′) and S.S.ITS2R (5′- ACACACATGAGCTTTTGTTTCG− 3′) were used and qPCR measurements were performed before the start of the experiment, after the bleaching experiment and after the symbiosis stability evaluation. |
| format | Dataset Open Access |
| id | pangaea_https___doi_org_10_1594_PANGAEA_984044 |
| institution | PANGAEA |
| language | en |
| publishDate | 2026 |
| publisher | PANGAEA |
| record_format | pangaea |
| spellingShingle | qPCR before and after bleaching and after symbiont switing in the foraminifera Sorites orbiculus Timme, Lukas Theodor Henschen, Helena Puerto Rueda, Diana N Manda, Sneha Parkinson, John Everett Wild, Christian Abramovich, Sigal Morard, Raphael Schmidt, Christiane assisted evolution; Date/Time, sample preparation; Density; Experimental condition; Experimental treatment; Gene copies; Gulf of Aqaba; menthol-DCMU bleaching; Method comment; qPCR; S_orbiculus_2023; Sampling by snorkeling; SNORKELING; Specimen number; Surface area; symbiont switching; Type of study The uptake of novel Symbiodiniaceae strains in Sorites orbiculus was measured using qPCR. To facilitate novel algae uptake, the specimens were bleached for 27 days with 0.19 mmol L-1 menthol and 5 µmol L-1 DCMU, followed by 19 days of re-inoculation with the Symbiodinium microadriaticum (strains KB8 and CCMP2467) and Fugacium kawagutii (strain F2) individually and collectively at a concentration of 1e5 cells ml-1 and a further observation for 37 days to verify long-term establishment of symbiosis. The primer pairs S.S.ITS2F (5′- TTCTGCTGCTCTTGTTATCAGG− 3′) and S.S.ITS2R (5′- ACACACATGAGCTTTTGTTTCG− 3′) were used and qPCR measurements were performed before the start of the experiment, after the bleaching experiment and after the symbiosis stability evaluation. |
| title | qPCR before and after bleaching and after symbiont switing in the foraminifera Sorites orbiculus |
| topic | assisted evolution; Date/Time, sample preparation; Density; Experimental condition; Experimental treatment; Gene copies; Gulf of Aqaba; menthol-DCMU bleaching; Method comment; qPCR; S_orbiculus_2023; Sampling by snorkeling; SNORKELING; Specimen number; Surface area; symbiont switching; Type of study |
| url | https://doi.org/10.1594/PANGAEA.984044 |