Saved in:
| Main Authors: | , , , , , , , , |
|---|---|
| Format: | Artículo científico |
| Language: | en |
| Published: |
International journal of biological macromolecules
2025
|
| Subjects: | |
| Online Access: | https://pubmed.ncbi.nlm.nih.gov/39800022/ |
| Tags: |
Add Tag
No Tags, Be the first to tag this record!
|
Table of Contents:
- Comprehensive analysis of the xbp1 gene in Pacific abalone Haliotis discus hannai: Structure, expression, and role in heat stress response. Huang, Dong Li, Xinxin Pan, Mingzhu Liu, Yue Qin, Gaochan Chen, Zhichu Yu, Xiaojun Mai, Kangsen Zhang, Wenbing Animals X-Box Binding Protein 1 Gastropoda Heat-Shock Response Gene Expression Regulation Endoplasmic Reticulum Chaperone BiP Promoter Regions, Genetic RNA, Messenger Base Sequence The present study explores the x-box binding protein 1 (xbp1) gene in Haliotis discus hannai (Pacific abalone), focusing on its structure, expression, and functional role under heat stress. Southern blot revealed two copies of xbp1 in the intestine and mantle, one in the gill and muscle, and no detection in the digestive gland. mRNA expression level of xbp1 was highest in the gill, followed by the mantle, intestine, and muscle, with the digestive gland showing the lowest expression. Actinomycin D treatment demonstrated that xbp1 mRNA stability varied among tissues, with slower degradation in the gill and mantle, while rapid degradation was observed in the digestive gland. Heat stress caused a 20 bp fragment removal from xbp1 mRNA, producing spliced xbp1 (xbp1s), with a conserved inositol-requiring enzyme 1α (IRE1α) cleavage motif (5'- CAGCACCUGCUGAUCCUCUG -3'). Genome walking was used to obtain the promoter sequences of downstream genes regulated by xbp1s. Through sequence conservation analysis, the binding sites of xbp1s on these promoters were identified in Pacific abalone. Yeast one-hybrid (Y1H) assays confirmed xbp1s binding to these sites, and morpholino oligonucleotides (MO) treatment effectively suppressed xbp1s production. Western blot analysis demonstrated that heat stress induced the expression of HDEL-related proteins, while MO injection significantly reduced their expression under both basal and heat stress conditions. Immunofluorescence analysis revealed decreased endoplasmic reticulum (ER) chaperone glucose-regulated protein 78 (GRP78) levels and increased apoptosis in MO-treated abalone under heat stress, suggesting a compromised ER stress response. These findings underscore XBP1's crucial role in regulating ER stress management and apoptotic processes, providing new insights into the functional significance of xbp1 in abalone's response to thermal stress.