Invertase production by Aspergillus and Penicillium and sequencing of an inv gene fragment

Fuente: Redalyc
Gespeichert in:
Bibliographische Detailangaben
1. Verfasser: A. C. Flores-Gallegos
Format: Artículo científico
Sprache:en
Veröffentlicht: Colegio de Postgraduados 2012
Schlagworte:
Online-Zugang:
Tags: Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
_version_ 1876439661527695360
author A. C. Flores-Gallegos
author_facet A. C. Flores-Gallegos
contents Invertase production by Aspergillus and Penicillium and sequencing of an inv gene fragment A. C. Flores-Gallegos F. Castillo-Reyes C. B. Lafuente J. C. Loyola-Licea M. H. Reyes-Valdés C. N. Aguilar R. Rodríguez Herrera Biología invertase Aspergillus Penicillium polyurethane foam invertase gene amplification Invertase (B-fructofuranosidase) is an enzyme used in the food industry, where sugar mixtures are preferred to glucose because they are sweeter and do not crystallize easily. In this study, a biochemical characterization of five fungal strains isolated from a Mexican semi-desert (Aspergillus niger GH1, A. fumigatus GS, Penicillium purpurogenum GH2, P. citrinum ESS, P. pinophilum EH2) was carried out. Evaluation of maximal growth of the strains on potato dextrose agar at several temperatures and pH values, as well as the assessment of invertase production using polyurethane foam as a non-biodegradable support, were performed. The highest growth rates corresponded to A. niger GH1 (0.2831 mm/h), and P. citrinum ESS (0.1931 mm/h). The maximum invertase yield was 81,270 U/L per min, determined for A. niger GH1 at 72 h. Oligonucleotide primers were designed for amplification of sequences from the invertase gene, InvF 5 ACGTCTGGCTGTCCGGTGAC and InvR 5 ACCGAACCCAAGTACTCAACGCA 3, showing an optimum annealing temperature of 61.6 C. DNA fragments of about 560 bp were obtained and sequenced, corresponding to the putative invertase gene of Aspergillus. 2012 artículo científico 1534-2581 https://www.redalyc.org/articulo.oa?id=68522692001 en http://www.redalyc.org/revista.oa?id=685 Micología Aplicada International application/pdf Colegio de Postgraduados Micología Aplicada International (México) Num.1 Vol.24
format Artículo científico
id redalyc_68522692001
institution Redalyc
language en
publishDate 2012
publisher Colegio de Postgraduados
spellingShingle Invertase production by Aspergillus and Penicillium and sequencing of an inv gene fragment
A. C. Flores-Gallegos
Biología
invertase
Aspergillus
Penicillium
polyurethane foam
invertase gene amplification
Invertase production by Aspergillus and Penicillium and sequencing of an inv gene fragment A. C. Flores-Gallegos F. Castillo-Reyes C. B. Lafuente J. C. Loyola-Licea M. H. Reyes-Valdés C. N. Aguilar R. Rodríguez Herrera Biología invertase Aspergillus Penicillium polyurethane foam invertase gene amplification Invertase (B-fructofuranosidase) is an enzyme used in the food industry, where sugar mixtures are preferred to glucose because they are sweeter and do not crystallize easily. In this study, a biochemical characterization of five fungal strains isolated from a Mexican semi-desert (Aspergillus niger GH1, A. fumigatus GS, Penicillium purpurogenum GH2, P. citrinum ESS, P. pinophilum EH2) was carried out. Evaluation of maximal growth of the strains on potato dextrose agar at several temperatures and pH values, as well as the assessment of invertase production using polyurethane foam as a non-biodegradable support, were performed. The highest growth rates corresponded to A. niger GH1 (0.2831 mm/h), and P. citrinum ESS (0.1931 mm/h). The maximum invertase yield was 81,270 U/L per min, determined for A. niger GH1 at 72 h. Oligonucleotide primers were designed for amplification of sequences from the invertase gene, InvF 5 ACGTCTGGCTGTCCGGTGAC and InvR 5 ACCGAACCCAAGTACTCAACGCA 3, showing an optimum annealing temperature of 61.6 C. DNA fragments of about 560 bp were obtained and sequenced, corresponding to the putative invertase gene of Aspergillus. 2012 artículo científico 1534-2581 https://www.redalyc.org/articulo.oa?id=68522692001 en http://www.redalyc.org/revista.oa?id=685 Micología Aplicada International application/pdf Colegio de Postgraduados Micología Aplicada International (México) Num.1 Vol.24
title Invertase production by Aspergillus and Penicillium and sequencing of an inv gene fragment
topic Biología
invertase
Aspergillus
Penicillium
polyurethane foam
invertase gene amplification
url https://www.redalyc.org/articulo.oa?id=68522692001