Saved in:
| Main Author: | |
|---|---|
| Format: | Recurso digital |
| Language: | |
| Published: |
Zenodo
2024
|
| Subjects: | |
| Online Access: | https://doi.org/10.5281/zenodo.13330142 |
| Tags: |
Add Tag
No Tags, Be the first to tag this record!
|
| _version_ | 1866901832462237696 |
|---|---|
| author | Grados, Juan |
| author_facet | Grados, Juan |
| contents | <p><b><i>Ernassa sanguinolenta</i> (Cramer, [1780])</b></p><p>(Figs. 7–16)</p><p><b>Diagnosis</b>: Body and wings intense reddish in almost all its surface. Forewing with a subproximal rounded, slightly lighter area in Cu 2 -1A+2A, and small dots at its sides; veins leaden. Base of the valva wide, dorsal process sclerotized, elongate and curved. Somewhat similar to <i>E. inexplorata</i> <b>sp. nov.</b>, but differing by the wider base of the valva and a more curved dorsal process, which is not directed towards the mesal margin.</p><p><b>Material examinado.</b> <b>PERÚ. LORETO.</b> 1 female, 7.5 km NO de Buenavista viejo, Río Arabela, 01°52’58”S, 75°22’19”W, 192 m, 21.iii.2013, C. Espinoza (GENITALIA # JGA-1316, MUSM). <b>AMAZONAS</b>. 1 male, Cordillera del Cóndor, P. V. Cap. Ponde Antúnez, 03°47’S, 76°21’W, 690 m, 16.xi.2003, J. Grados & A. Asenjo. <b>HUÁNUCO</b>. 1 male, Estación Biológica Panguana, 09°38’36”S, 74°54’55”W, 260 m, 13.iii.2018, J. Monzón (GENITALIA # JGA-1235, MUSM). <b>CUSCO</b>. 1 male, Estación Biológica Villa Carmen, 12°53’41.2”S, 71°24’14.7”W, 520 m, 31.i.2020, D. Bolt. <b>MADRE DE DIOS</b>. 1 male, Albergue Refugio Amazonas, 12°52’30”S, 69°24’35”W, 231 m, 11.vii.2017, D. Couceiro <i>et al.</i> (MUSM, ART-686 JGA COLLECTION)(Voucher DNA barcoding, Arct #349 JGA-MUSM); 1 male, Río Alto Madre de Dios, ca. Atalaya, 12°53’S, 71°22’W, 587 m, 03.v.2006, P. Centeno; 1 male, Tambopata Research Center, 13°08’03”S, 69°36’39”W, 239 m, 01.iii.–31.x.2021, A. Avellaneda, G. Serrano & J. Grados (GENITALIA # JGA-1236, MUSM). All deposited in the MUSM.</p><p><b>Male</b> (Figs. 7–8). Description of the adult male and genital organs is found in Travassos (1944). Male genitalia (Figs. 11–14) (Genitalia # JGA- 1235, 1236, MUSM). Narrow-sided tegumen, anterior margin shaped as an inverted “U”. Uncus somewhat wider than the distal part of tegumen; two “L”-shaped, very sclerotized lateral processes, very wide at the base, with abundant long setae on their mesal side and converging on the dorsal side of the uncus; distal part short, pointed and hook-shaped at its end, a concave notch on its ventral part. Saccus concave at its central part. Valva. Lateral view: wide at its base; convex on dorsal margin; ventral process membranous, elongate, margin of distal end truncate; presence of elongate setae on the ventral margin; dorsal process sclerotized, curved downward ventrally, shorter than the base. Ventral view: narrow at the base; mesal margin of the proximal half, slightly concave, with abundant setae at its distal end; distal half invaginated, markedly sclerotized; dorsal process sclerotized and curved, with setae at the distal end. Juxta trapezoidal, with a wide membranous area at the anterior central part. Transtilla digitiform and sclerotized. Aedeagus elongate and somewhat sinusoid; coecum penis elongate; vesica membranous, short, with small spicules over most of its surface.</p><p><b>Female</b> (Figs. 9–10). Forewing span (31 mm) (n=1). Same characteristics of the male, except for: rami smaller than the flagellum and without retinaculum. Four bristles on the frenulum. Genitalia (Figs.15–16) (Genitalia # JGA-1316, MUSM). Eighth tergite slightly sclerotized. Papillae taller than wide, more pubescent on the dorsal part. Posterior apophyses longer than the anterior ones; the latter almost undeveloped. Eighth sternite with two lateral, triangular-shaped extensions. Lamella antivaginalis and postvaginalis sclerotized. Ductus bursae short, flattened, and sclerotized. Cervix bursae somewhat globose and membranous. Corpus bursae globose and membranous. Two signa, long and narrow, somewhat curved at the ventral side of the Corpus bursae. Ductus seminalis arising from the left side of the Cervix bursae.</p><p><b>Barcoding</b>: The mitochondrial DNA (COI) sequence of one of the specimens is as follows (Voucher MUSMArctiinae VBC #349) (GenBank: BankIt2839965 gnl|uoguelph| RFEWA 349-17.COI-5P PP911855) (See Table 1).</p><p>AACATTATACTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACTTCATTAAGTTTACTAATCCGT GCTGAATTAGGAAATCCAGGATCTTTAATCGGAGATGATCAAATCTATAACACTATTGTTACAG C A C AT G C C T T TAT TATA AT T T T T T T TATA G T TATA C C A AT TATA AT C G G A G G T T T C G G TA AT T GATTAGTTCCTCTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGAATAAATAATATAAGTTTTT GACTTTTACCCCCATCATTAACTTTACTAATTTCAAGAAGAATTGTTGAAAATGGAGCTGGAACAG GATGAACAGTTTACCCCCCACTTTCATCTAATATTGCCCATAGTGGAAGTTCAGTAGATTTAGC TATTTTCTCCCTACATTTAGCAGGAATTTCTTCAATTTTAGGTGCTATTAACTTTATTACAACAATCAT CAATATACGATTAAATAATTTATCATTTGATCAAATACCATTATTTGTATGAGCAGTAGGAATTACTG CATTTCTTTTATTACTTTCATTACCTGTTTTAGCAGGAGCTATTACTATACTTTTAACTGATCGAAATTTA AATACTTCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTCTTTATCAACATTTATTT</p><p><b>Distribution</b>: Brazil (Travassos, 1944) and Peru (Amazonas, Huánuco, Cusco and Madre de Dios).</p><p><b>Remarks</b>. The species was described by Cramer ([1780]) with specimens from Suriname, with no mention of the number of specimens. Like <i>E. justina</i>, the high probability of the type being lost led Travassos (1944) to designate a Neotype, using a specimen from Obidos, State of Pará (Brazil) (Neo-typus: Nº60.023, ignotus, Boy, VI-925, male), deposited in the <b>MNRJ</b>. With the disaster of September 2, 2018 at the National Museum of Rio de Janeiro, the neotype disappeared (Escobar 2018). The drawings published by Travassos (1944) on the morphology of the male genitalia allowed the identification of the species.</p> |
| format | Recurso digital |
| id | zenodo_https___doi_org_10_5281_zenodo_13330142 |
| institution | Zenodo |
| language | |
| publishDate | 2024 |
| publisher | Zenodo |
| record_format | zenodo |
| spellingShingle | Ernassa sanguinolenta Grados, Juan Biodiversity Taxonomy Animalia Arthropoda Insecta Lepidoptera Erebidae Ernassa Ernassa sanguinolenta <p><b><i>Ernassa sanguinolenta</i> (Cramer, [1780])</b></p><p>(Figs. 7–16)</p><p><b>Diagnosis</b>: Body and wings intense reddish in almost all its surface. Forewing with a subproximal rounded, slightly lighter area in Cu 2 -1A+2A, and small dots at its sides; veins leaden. Base of the valva wide, dorsal process sclerotized, elongate and curved. Somewhat similar to <i>E. inexplorata</i> <b>sp. nov.</b>, but differing by the wider base of the valva and a more curved dorsal process, which is not directed towards the mesal margin.</p><p><b>Material examinado.</b> <b>PERÚ. LORETO.</b> 1 female, 7.5 km NO de Buenavista viejo, Río Arabela, 01°52’58”S, 75°22’19”W, 192 m, 21.iii.2013, C. Espinoza (GENITALIA # JGA-1316, MUSM). <b>AMAZONAS</b>. 1 male, Cordillera del Cóndor, P. V. Cap. Ponde Antúnez, 03°47’S, 76°21’W, 690 m, 16.xi.2003, J. Grados & A. Asenjo. <b>HUÁNUCO</b>. 1 male, Estación Biológica Panguana, 09°38’36”S, 74°54’55”W, 260 m, 13.iii.2018, J. Monzón (GENITALIA # JGA-1235, MUSM). <b>CUSCO</b>. 1 male, Estación Biológica Villa Carmen, 12°53’41.2”S, 71°24’14.7”W, 520 m, 31.i.2020, D. Bolt. <b>MADRE DE DIOS</b>. 1 male, Albergue Refugio Amazonas, 12°52’30”S, 69°24’35”W, 231 m, 11.vii.2017, D. Couceiro <i>et al.</i> (MUSM, ART-686 JGA COLLECTION)(Voucher DNA barcoding, Arct #349 JGA-MUSM); 1 male, Río Alto Madre de Dios, ca. Atalaya, 12°53’S, 71°22’W, 587 m, 03.v.2006, P. Centeno; 1 male, Tambopata Research Center, 13°08’03”S, 69°36’39”W, 239 m, 01.iii.–31.x.2021, A. Avellaneda, G. Serrano & J. Grados (GENITALIA # JGA-1236, MUSM). All deposited in the MUSM.</p><p><b>Male</b> (Figs. 7–8). Description of the adult male and genital organs is found in Travassos (1944). Male genitalia (Figs. 11–14) (Genitalia # JGA- 1235, 1236, MUSM). Narrow-sided tegumen, anterior margin shaped as an inverted “U”. Uncus somewhat wider than the distal part of tegumen; two “L”-shaped, very sclerotized lateral processes, very wide at the base, with abundant long setae on their mesal side and converging on the dorsal side of the uncus; distal part short, pointed and hook-shaped at its end, a concave notch on its ventral part. Saccus concave at its central part. Valva. Lateral view: wide at its base; convex on dorsal margin; ventral process membranous, elongate, margin of distal end truncate; presence of elongate setae on the ventral margin; dorsal process sclerotized, curved downward ventrally, shorter than the base. Ventral view: narrow at the base; mesal margin of the proximal half, slightly concave, with abundant setae at its distal end; distal half invaginated, markedly sclerotized; dorsal process sclerotized and curved, with setae at the distal end. Juxta trapezoidal, with a wide membranous area at the anterior central part. Transtilla digitiform and sclerotized. Aedeagus elongate and somewhat sinusoid; coecum penis elongate; vesica membranous, short, with small spicules over most of its surface.</p><p><b>Female</b> (Figs. 9–10). Forewing span (31 mm) (n=1). Same characteristics of the male, except for: rami smaller than the flagellum and without retinaculum. Four bristles on the frenulum. Genitalia (Figs.15–16) (Genitalia # JGA-1316, MUSM). Eighth tergite slightly sclerotized. Papillae taller than wide, more pubescent on the dorsal part. Posterior apophyses longer than the anterior ones; the latter almost undeveloped. Eighth sternite with two lateral, triangular-shaped extensions. Lamella antivaginalis and postvaginalis sclerotized. Ductus bursae short, flattened, and sclerotized. Cervix bursae somewhat globose and membranous. Corpus bursae globose and membranous. Two signa, long and narrow, somewhat curved at the ventral side of the Corpus bursae. Ductus seminalis arising from the left side of the Cervix bursae.</p><p><b>Barcoding</b>: The mitochondrial DNA (COI) sequence of one of the specimens is as follows (Voucher MUSMArctiinae VBC #349) (GenBank: BankIt2839965 gnl|uoguelph| RFEWA 349-17.COI-5P PP911855) (See Table 1).</p><p>AACATTATACTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACTTCATTAAGTTTACTAATCCGT GCTGAATTAGGAAATCCAGGATCTTTAATCGGAGATGATCAAATCTATAACACTATTGTTACAG C A C AT G C C T T TAT TATA AT T T T T T T TATA G T TATA C C A AT TATA AT C G G A G G T T T C G G TA AT T GATTAGTTCCTCTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGAATAAATAATATAAGTTTTT GACTTTTACCCCCATCATTAACTTTACTAATTTCAAGAAGAATTGTTGAAAATGGAGCTGGAACAG GATGAACAGTTTACCCCCCACTTTCATCTAATATTGCCCATAGTGGAAGTTCAGTAGATTTAGC TATTTTCTCCCTACATTTAGCAGGAATTTCTTCAATTTTAGGTGCTATTAACTTTATTACAACAATCAT CAATATACGATTAAATAATTTATCATTTGATCAAATACCATTATTTGTATGAGCAGTAGGAATTACTG CATTTCTTTTATTACTTTCATTACCTGTTTTAGCAGGAGCTATTACTATACTTTTAACTGATCGAAATTTA AATACTTCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTCTTTATCAACATTTATTT</p><p><b>Distribution</b>: Brazil (Travassos, 1944) and Peru (Amazonas, Huánuco, Cusco and Madre de Dios).</p><p><b>Remarks</b>. The species was described by Cramer ([1780]) with specimens from Suriname, with no mention of the number of specimens. Like <i>E. justina</i>, the high probability of the type being lost led Travassos (1944) to designate a Neotype, using a specimen from Obidos, State of Pará (Brazil) (Neo-typus: Nº60.023, ignotus, Boy, VI-925, male), deposited in the <b>MNRJ</b>. With the disaster of September 2, 2018 at the National Museum of Rio de Janeiro, the neotype disappeared (Escobar 2018). The drawings published by Travassos (1944) on the morphology of the male genitalia allowed the identification of the species.</p> |
| title | Ernassa sanguinolenta |
| topic | Biodiversity Taxonomy Animalia Arthropoda Insecta Lepidoptera Erebidae Ernassa Ernassa sanguinolenta |
| url | https://doi.org/10.5281/zenodo.13330142 |