Table des matières: :: Library Catalog

Enregistré dans:

Détails bibliographiques
Auteurs principaux:	Klak, Cornelia, Hedderson, Terry A., Linder, H. Peter
Format:	Recurso digital
Langue:
Publié:	Zenodo 2003
Sujets:	Biodiversity Taxonomy
Accès en ligne:	https://doi.org/10.5281/zenodo.15156712
Tags:	Ajouter un tag Pas de tags, Soyez le premier à ajouter un tag!

Table des matières:

<p>TABLE 1. Primer sequences (5′–3′) used in this study for amplification and sequencing of the <i>trnL-F,</i> ITS and <i>5S</i> gene regions.</p><table><thead><tr><th><i>trnL-F</i> region:</th><th>c (CGAAATCGGTAGACGCTACG), d (GGGGATAGAGGGACTTGAAC), e (GGTTCA</th></tr></thead><tbody><tr><th></th><td>AGTCCCTCTATCCC), f (TTTGAACTGGTGACACGAG).</td></tr><tr><th>ITS gene region:</th><td>ITS 4 (TCCTCCGCTTATTGATATGC), ITS 5 (GGAAGTAAAAGTCGTAACAAGG).</td></tr><tr><th><i>5S NTS</i> gene region:</th><td>P3 (GAGAGTAGTACATCGATGGG), P4 (GGAGTTCTGACGGGATCCGG).</td></tr></tbody></table>

Documents similaires