TABLE 1 in A new species of planthopper in the genus Colpoptera (Hemiptera: Fulgoroidea: Nogodinidae) from the Caribbean coast of Costa Rica
Fuente:
Zenodo
Salvato in:
| Autori principali: | , , , , , , , , |
|---|---|
| Natura: | Recurso digital |
| Pubblicazione: |
Zenodo
2024
|
| Soggetti: | |
| Accesso online: | |
| Tags: |
Aggiungi Tag
Nessun Tag, puoi essere il primo ad aggiungerne!!
|
| _version_ | 1866901138594332672 |
|---|---|
| author | Barrantes Barrantes, Edwin A. Zumbado Echavarria, Marco A. Van Dam, Alex R. Helmick, Ericka E. Bartlett, Charles R. Martinez Aponte, Laura V. Ruiz, Alfredo Rodriguez Bloch, Melody Bahder, Brian W. |
| author_facet | Barrantes Barrantes, Edwin A. Zumbado Echavarria, Marco A. Van Dam, Alex R. Helmick, Ericka E. Bartlett, Charles R. Martinez Aponte, Laura V. Ruiz, Alfredo Rodriguez Bloch, Melody Bahder, Brian W. |
| contents | <p><b>TABLE 1.</b> Primers used to amplify corresponding gene regions used to assess placement of novel taxon and PCR parameters for each locus.</p><table><thead><tr><th>Locus</th><th>Primer</th><th>Direction</th><th>Sequence (5’ <b>6</b> 3’)</th><th>Annealing</th><th>Extension</th><th>Reference</th></tr></thead><tbody><tr><th>18S</th><td>18SF 18SR</td><td>Forward Reverse</td><td>ACTGTCGATGGTAGGTTCTG GTCCGAAGACCTCACTAAA</td><td>50˚C</td><td>2 min.</td><td>Bahder <i>et al.</i> 2019</td></tr><tr><th>28S</th><td>V X</td><td>Forward Reverse</td><td>GTAGCCAAATGCCTCGTCA CACAATGATAGGAAGAGCC</td><td>55˚C</td><td>1 min. 30 sec.</td><td>Cryan <i>et al.</i> 2000</td></tr></tbody></table> |
| format | Recurso digital |
| id | zenodo_https___doi_org_10_5281_zenodo_15158344 |
| institution | Zenodo |
| language | |
| publishDate | 2024 |
| publisher | Zenodo |
| record_format | zenodo |
| spellingShingle | TABLE 1 in A new species of planthopper in the genus Colpoptera (Hemiptera: Fulgoroidea: Nogodinidae) from the Caribbean coast of Costa Rica Barrantes Barrantes, Edwin A. Zumbado Echavarria, Marco A. Van Dam, Alex R. Helmick, Ericka E. Bartlett, Charles R. Martinez Aponte, Laura V. Ruiz, Alfredo Rodriguez Bloch, Melody Bahder, Brian W. Biodiversity Taxonomy <p><b>TABLE 1.</b> Primers used to amplify corresponding gene regions used to assess placement of novel taxon and PCR parameters for each locus.</p><table><thead><tr><th>Locus</th><th>Primer</th><th>Direction</th><th>Sequence (5’ <b>6</b> 3’)</th><th>Annealing</th><th>Extension</th><th>Reference</th></tr></thead><tbody><tr><th>18S</th><td>18SF 18SR</td><td>Forward Reverse</td><td>ACTGTCGATGGTAGGTTCTG GTCCGAAGACCTCACTAAA</td><td>50˚C</td><td>2 min.</td><td>Bahder <i>et al.</i> 2019</td></tr><tr><th>28S</th><td>V X</td><td>Forward Reverse</td><td>GTAGCCAAATGCCTCGTCA CACAATGATAGGAAGAGCC</td><td>55˚C</td><td>1 min. 30 sec.</td><td>Cryan <i>et al.</i> 2000</td></tr></tbody></table> |
| title | TABLE 1 in A new species of planthopper in the genus Colpoptera (Hemiptera: Fulgoroidea: Nogodinidae) from the Caribbean coast of Costa Rica |
| topic | Biodiversity Taxonomy |
| url | https://doi.org/10.5281/zenodo.15158344 |