Telegonus chiriquensis Staudinger 1875
Fuente:
Zenodo
Gespeichert in:
| Hauptverfasser: | , , , , |
|---|---|
| Format: | Recurso digital |
| Veröffentlicht: |
Zenodo
2025
|
| Schlagworte: | |
| Online-Zugang: | |
| Tags: |
Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
|
| _version_ | 1866901915708686336 |
|---|---|
| author | Zhang, Jing Cong, Qian Shen, Jinhui Song, Leina Grishin, Nick V. |
| author_facet | Zhang, Jing Cong, Qian Shen, Jinhui Song, Leina Grishin, Nick V. |
| contents | <p><b>Lectotype designation for <i>Telegonus chiriquensis</i> Staudinger, 1875</b></p><p><i>Telegonus chiriquensis</i> was described from a series of several males and females collected by Heinrich Ribbe in Chiriquí, Panama, with a single (“somewhat differing”) specimen from Panama, Panama (Staudinger 1875). Furthermore, Staudinger illustrated <i>T. chiriquensis</i> in a later publication (Staudinger 1884 –1888). We located syntypes of this species in MFNB (3♂♂ and 2♀♀ labeled as “Origin.”) and ZSMC (1♂ and 1♀ labeled as “ Paratype ”). Genomic sequencing of several syntypes reveals that the type series of <i>T. chiriquensis</i> is polytypic and consists of at least two species not most closely related to each other (Fig. 61). Phenotypic inspection confirms this conclusion. One specimen (sequenced as NVG-15031B10, Fig. 75d), which bears the largest number of labels, including “chiriquensis Stgr ” (likely in Staudinger’s handwriting), “bifascia H. S” (possibly in Hewitson’s handwriting), “ Lectotypus ” (probably added by or by the request of Olaf H. H. Mielke), and “ LECTOTYPE ♂ Telegonus | chiriquensis | Staudinger, 1875 | designated by: S.R. Steinhauser” (added by Steinhauser), is a male conspecific with <i>Thymele grullus</i> Mabille, 1888 (type locality in Panama: Chiriquí, lectotype sequenced as NVG-15031B12), as evidenced by genomic sequencing (Fig. 61). A lectotype designation has not been published for <i>T. chiriquensis</i>, however, Steinhauser (1987) wrote: “I have examined a syntype of this … taxon from the type series in the ZMHU which I will designate as lectotype in a future paper” referring to this syntype NVG-15031B 10 in MFNB. Other syntypes of <i>T. chiriquensis</i> belong to a species that has been referred to as <i>chiriquensis</i> in most literature, e.g., in Evans (1952).</p><p>It is unclear why Steinhauser decided to designate this syntype, which is not conspecific with the rest of the type series, as the lectotype. It is possible that it was the only syntype he inspected, not seeing others. This syntype was likely the only one mailed to Steinhauser from Berlin. We believe that Steinhauser worked with this syntype in Sarasota, FL, USA (the Allyn Museum of Entomology location) and not in Berlin, because this specimen carries a label “Allyn Museum Photo No. <i>89/2/3/16,17 900102/1,2</i> ” with numbers in italics in Steinhauser’s handwriting indicating that the photo may have been taken in Sarasota, and also a label “Zool. Mus. Berlin”, likely added by Steinhauser to keep track of loaned specimens. This syntype was probably selected to be mailed to Sarasota because it was the first one in the series (top left, right below the header label with the name “chiriquensis | Staudinger ”) and has accumulated the largest number of labels, including the identification label “chiriquensis Stgr ”.</p><p>All other syntypes in MFNB, the collection with the largest number of syntypes, only have the following three labels: “Origin.”, “ Chiriqui | Ribbe”, and “ Paralectotypus ”, except one of the females with an additional label “ Telegonus | chiriquensis” indicating that this was the specimen loaned to Godman and Salvin (1893) as mentioned in their book: “Dr. Staudinger has kindly lent us his type of this species, and also a male, which he considered to belong to <i>T. elorus</i> of Hewitson.” Handwriting on this identification label is consistent with that of Godman. A similar-styled label written by the same person is placed on the lectotype of <i>T. grullus</i>, about which Godman and Salvin (1893) wrote: “the type lent us by Dr. Staudinger”. From these considerations, we deduce that the female syntype with the label “ Telegonus | chiriquensis” was considered to be “his type” of this species by Staudinger. On the one hand, mentioning this female as “type” by Godman and Salvin (1893) does not constitute a lectotype designation according to the ICZN Code Art. 74.6. because the original description of <i>T. chiriquensis</i> mentions more than one specimen, implying that the name was proposed from a series of syntypes (Staudinger 1875). On the other hand, it was Godman and Salvin (1893), and not Mielke and Casagrande (2002), who designated a lectotype of <i>T. grullus</i> by referring to “the type” (Art. 74.6.) because the original description had no implications about the number of specimens involved (Mabille 1888). Both designations refer to the same specimen. In summary, our analysis suggests that Staudinger considered the species that is not <i>T. grullus</i> to represent his concept of <i>T. chiriquensis</i> better.</p><p>This is further evidenced by an illustration of <i>T. chiriquensis</i> in the book that he authored and coedited (Staudinger 1884 –1888). This illustration, reproduced here in Fig. 75c, is particularly similar to one of the male specimens in the MFNB collection that is also not <i>T. grullus</i>. The two species can be told apart by the color of the ventral hindwing from the vein 1A+2A to the inner margin (anal fold). The anal fold beneath is entirely brownish in <i>T. grullus</i> (Fig. 75d right), while it is partly yellow towards the tornus in the other species (Fig. 75a–c right). Staudinger’s illustration shows an entirely yellow tornus up to the inner margin (Fig. 75c right), allowing unambiguous selection of the illustrated species from the type series of <i>T. chiriquensis</i>. Moreover, broader wing shape and more interconnected ventral forewing dark bands agree better with the species that is not <i>T. grullus</i>. Furthermore, Staudinger’s illustration shows a brown patch directed toward the tornus within the yellow area along the vein 1A+2A on the ventral hindwing. Only one of the syntypes possesses this patch and otherwise agrees best with the illustration.</p><p>Finally, the illustrations of <i>T. chiriquensis</i> in Draudt (1922), reproduced here in Fig. 75b, do not depict <i>T. grullus</i> either, but it is not clear whether they—ventral and dorsal side, possibly of two different specimens due to the wing shape difference: male (ventral) and female (dorsal)—show syntypes or even specimens conspecific with the syntypes of <i>T. chiriquensis</i>. It is conceivable that they are copies of Plötz’s unpublished and possibly lost drawing t. 1342 (Godman 1907) of <i>A. weymeri</i>, which was regarded as a junior subjective synonym of <i>T. chiriquensis</i> by Draudt (1922). For all these reasons, we arrived at the conclusion that this “future lectotype ” inspected by Steinhauser (which is <i>T. grullus</i>) is not the best choice to represent Staudinger’s concept of <i>T. chiriquensis</i>. We believe that both the historical accuracy (i.e., selecting the species dominant in the type series, which is also the species illustrated in a book by the author of this taxon) and the stability of nomenclature (i.e., the species that has been regarded as <i>T. chiriquensis</i> in the most widely accepted works since the original description, such as Godman and Salvin (1893) and Evans (1952), in part) would be served better by designating a specimen different from the one inspected by Steinhauser as the lectotype of <i>T. chiriquensis</i>.</p><p>Therefore, to stabilize nomenclature and to select one species out of the polytypic type series, N.V.G. hereby designates a syntype in the MFNB collection, a male illustrated in Fig. 75a and bearing the following five rectangular labels (1 st purple, 3 rd red, others white): [Origin.], [Chiriqui | Ribbe], [Paralectotypus], [{QR Code} http://coll.mfn-berlin.de/u/ | e1f9d5], and [DNA sample ID: | NVG-24028C04 | c/o Nick V. Grishin] as the <b>lectotype</b> of <i>Telegonus chiriquensis</i> Staudinger 1875. The lectotype has a scar on its right forewing dorsal side starting from a chipped outer margin near the apex, directed towards the middle of the inner margin, and reaching the vein CuA 1. The lectotype (Fig. 75a) resembles Staudinger’s illustration (1884–1888) (Fig. 75c) more than paralectotypes in MFNB (e.g., Fig. 75d). Moreover, our choice of the species to be selected from the type series as <i>T chiriquensis</i> also makes better use of existing names. If the syntype of <i>T. chiriquensis</i> that is conspecific with <i>T. grullus</i> is selected as the lectotype, then <i>T. grullus</i> would become a junior subjective synonym of <i>T. chiriquensis</i>, but the second species represented by several syntypes of <i>T. chiriquensis</i> would not have an available name associated with it and would become a “new” species that needs a name. However, this second species is prevalent in the type series (only one former syntype is conspecific with <i>T. grullus</i>) and, as we discussed above, Staudinger and subsequent literature, including Evans (1952) (in part), regarded this prevalent species as <i>T. chiriquensis</i>. The COI barcode sequence of the lectotype, sample NVG-24028C04, GenBank PV550021, 658 base pairs, is: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCTTTAAGATTACTCATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACC ATTGTAACAGCTCACGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTCCCATTAATAATAGGAGCCCCTGATATAGCTTTTCCTCGTA TAAATAATATAAGATTTTGACTTTTACCCCCGTCATTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGTGCTGGAACAGGATGAACAGTTTATCCCCCCCTTTCATCTAATATTGC CCATCAAGGAGCATCAGTTGATTTAGCTATTTTTTCCTTACATTTAGCTGGTATTTCCTCTATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCT TTTGATCAAATACCATTATTTGTTTGAGCTGTAGGAATTACAGCATTATTATTATTACTTTCACTACCAGTTTTAGCAGGAGCTATTACCATATTATTAACTGATCGAAATTTAAATACTT CATTTTTTGATCCAGCTGGGGGAGGAGATCCAATTTTATACCAACATTTATTT</p> |
| format | Recurso digital |
| id | zenodo_https___doi_org_10_5281_zenodo_16804283 |
| institution | Zenodo |
| language | |
| publishDate | 2025 |
| publisher | Zenodo |
| record_format | zenodo |
| spellingShingle | Telegonus chiriquensis Staudinger 1875 Zhang, Jing Cong, Qian Shen, Jinhui Song, Leina Grishin, Nick V. Biodiversity Taxonomy Animalia Arthropoda Insecta Lepidoptera Hesperiidae Telegonus Telegonus chiriquensis <p><b>Lectotype designation for <i>Telegonus chiriquensis</i> Staudinger, 1875</b></p><p><i>Telegonus chiriquensis</i> was described from a series of several males and females collected by Heinrich Ribbe in Chiriquí, Panama, with a single (“somewhat differing”) specimen from Panama, Panama (Staudinger 1875). Furthermore, Staudinger illustrated <i>T. chiriquensis</i> in a later publication (Staudinger 1884 –1888). We located syntypes of this species in MFNB (3♂♂ and 2♀♀ labeled as “Origin.”) and ZSMC (1♂ and 1♀ labeled as “ Paratype ”). Genomic sequencing of several syntypes reveals that the type series of <i>T. chiriquensis</i> is polytypic and consists of at least two species not most closely related to each other (Fig. 61). Phenotypic inspection confirms this conclusion. One specimen (sequenced as NVG-15031B10, Fig. 75d), which bears the largest number of labels, including “chiriquensis Stgr ” (likely in Staudinger’s handwriting), “bifascia H. S” (possibly in Hewitson’s handwriting), “ Lectotypus ” (probably added by or by the request of Olaf H. H. Mielke), and “ LECTOTYPE ♂ Telegonus | chiriquensis | Staudinger, 1875 | designated by: S.R. Steinhauser” (added by Steinhauser), is a male conspecific with <i>Thymele grullus</i> Mabille, 1888 (type locality in Panama: Chiriquí, lectotype sequenced as NVG-15031B12), as evidenced by genomic sequencing (Fig. 61). A lectotype designation has not been published for <i>T. chiriquensis</i>, however, Steinhauser (1987) wrote: “I have examined a syntype of this … taxon from the type series in the ZMHU which I will designate as lectotype in a future paper” referring to this syntype NVG-15031B 10 in MFNB. Other syntypes of <i>T. chiriquensis</i> belong to a species that has been referred to as <i>chiriquensis</i> in most literature, e.g., in Evans (1952).</p><p>It is unclear why Steinhauser decided to designate this syntype, which is not conspecific with the rest of the type series, as the lectotype. It is possible that it was the only syntype he inspected, not seeing others. This syntype was likely the only one mailed to Steinhauser from Berlin. We believe that Steinhauser worked with this syntype in Sarasota, FL, USA (the Allyn Museum of Entomology location) and not in Berlin, because this specimen carries a label “Allyn Museum Photo No. <i>89/2/3/16,17 900102/1,2</i> ” with numbers in italics in Steinhauser’s handwriting indicating that the photo may have been taken in Sarasota, and also a label “Zool. Mus. Berlin”, likely added by Steinhauser to keep track of loaned specimens. This syntype was probably selected to be mailed to Sarasota because it was the first one in the series (top left, right below the header label with the name “chiriquensis | Staudinger ”) and has accumulated the largest number of labels, including the identification label “chiriquensis Stgr ”.</p><p>All other syntypes in MFNB, the collection with the largest number of syntypes, only have the following three labels: “Origin.”, “ Chiriqui | Ribbe”, and “ Paralectotypus ”, except one of the females with an additional label “ Telegonus | chiriquensis” indicating that this was the specimen loaned to Godman and Salvin (1893) as mentioned in their book: “Dr. Staudinger has kindly lent us his type of this species, and also a male, which he considered to belong to <i>T. elorus</i> of Hewitson.” Handwriting on this identification label is consistent with that of Godman. A similar-styled label written by the same person is placed on the lectotype of <i>T. grullus</i>, about which Godman and Salvin (1893) wrote: “the type lent us by Dr. Staudinger”. From these considerations, we deduce that the female syntype with the label “ Telegonus | chiriquensis” was considered to be “his type” of this species by Staudinger. On the one hand, mentioning this female as “type” by Godman and Salvin (1893) does not constitute a lectotype designation according to the ICZN Code Art. 74.6. because the original description of <i>T. chiriquensis</i> mentions more than one specimen, implying that the name was proposed from a series of syntypes (Staudinger 1875). On the other hand, it was Godman and Salvin (1893), and not Mielke and Casagrande (2002), who designated a lectotype of <i>T. grullus</i> by referring to “the type” (Art. 74.6.) because the original description had no implications about the number of specimens involved (Mabille 1888). Both designations refer to the same specimen. In summary, our analysis suggests that Staudinger considered the species that is not <i>T. grullus</i> to represent his concept of <i>T. chiriquensis</i> better.</p><p>This is further evidenced by an illustration of <i>T. chiriquensis</i> in the book that he authored and coedited (Staudinger 1884 –1888). This illustration, reproduced here in Fig. 75c, is particularly similar to one of the male specimens in the MFNB collection that is also not <i>T. grullus</i>. The two species can be told apart by the color of the ventral hindwing from the vein 1A+2A to the inner margin (anal fold). The anal fold beneath is entirely brownish in <i>T. grullus</i> (Fig. 75d right), while it is partly yellow towards the tornus in the other species (Fig. 75a–c right). Staudinger’s illustration shows an entirely yellow tornus up to the inner margin (Fig. 75c right), allowing unambiguous selection of the illustrated species from the type series of <i>T. chiriquensis</i>. Moreover, broader wing shape and more interconnected ventral forewing dark bands agree better with the species that is not <i>T. grullus</i>. Furthermore, Staudinger’s illustration shows a brown patch directed toward the tornus within the yellow area along the vein 1A+2A on the ventral hindwing. Only one of the syntypes possesses this patch and otherwise agrees best with the illustration.</p><p>Finally, the illustrations of <i>T. chiriquensis</i> in Draudt (1922), reproduced here in Fig. 75b, do not depict <i>T. grullus</i> either, but it is not clear whether they—ventral and dorsal side, possibly of two different specimens due to the wing shape difference: male (ventral) and female (dorsal)—show syntypes or even specimens conspecific with the syntypes of <i>T. chiriquensis</i>. It is conceivable that they are copies of Plötz’s unpublished and possibly lost drawing t. 1342 (Godman 1907) of <i>A. weymeri</i>, which was regarded as a junior subjective synonym of <i>T. chiriquensis</i> by Draudt (1922). For all these reasons, we arrived at the conclusion that this “future lectotype ” inspected by Steinhauser (which is <i>T. grullus</i>) is not the best choice to represent Staudinger’s concept of <i>T. chiriquensis</i>. We believe that both the historical accuracy (i.e., selecting the species dominant in the type series, which is also the species illustrated in a book by the author of this taxon) and the stability of nomenclature (i.e., the species that has been regarded as <i>T. chiriquensis</i> in the most widely accepted works since the original description, such as Godman and Salvin (1893) and Evans (1952), in part) would be served better by designating a specimen different from the one inspected by Steinhauser as the lectotype of <i>T. chiriquensis</i>.</p><p>Therefore, to stabilize nomenclature and to select one species out of the polytypic type series, N.V.G. hereby designates a syntype in the MFNB collection, a male illustrated in Fig. 75a and bearing the following five rectangular labels (1 st purple, 3 rd red, others white): [Origin.], [Chiriqui | Ribbe], [Paralectotypus], [{QR Code} http://coll.mfn-berlin.de/u/ | e1f9d5], and [DNA sample ID: | NVG-24028C04 | c/o Nick V. Grishin] as the <b>lectotype</b> of <i>Telegonus chiriquensis</i> Staudinger 1875. The lectotype has a scar on its right forewing dorsal side starting from a chipped outer margin near the apex, directed towards the middle of the inner margin, and reaching the vein CuA 1. The lectotype (Fig. 75a) resembles Staudinger’s illustration (1884–1888) (Fig. 75c) more than paralectotypes in MFNB (e.g., Fig. 75d). Moreover, our choice of the species to be selected from the type series as <i>T chiriquensis</i> also makes better use of existing names. If the syntype of <i>T. chiriquensis</i> that is conspecific with <i>T. grullus</i> is selected as the lectotype, then <i>T. grullus</i> would become a junior subjective synonym of <i>T. chiriquensis</i>, but the second species represented by several syntypes of <i>T. chiriquensis</i> would not have an available name associated with it and would become a “new” species that needs a name. However, this second species is prevalent in the type series (only one former syntype is conspecific with <i>T. grullus</i>) and, as we discussed above, Staudinger and subsequent literature, including Evans (1952) (in part), regarded this prevalent species as <i>T. chiriquensis</i>. The COI barcode sequence of the lectotype, sample NVG-24028C04, GenBank PV550021, 658 base pairs, is: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCTTTAAGATTACTCATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACC ATTGTAACAGCTCACGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTCCCATTAATAATAGGAGCCCCTGATATAGCTTTTCCTCGTA TAAATAATATAAGATTTTGACTTTTACCCCCGTCATTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGTGCTGGAACAGGATGAACAGTTTATCCCCCCCTTTCATCTAATATTGC CCATCAAGGAGCATCAGTTGATTTAGCTATTTTTTCCTTACATTTAGCTGGTATTTCCTCTATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCT TTTGATCAAATACCATTATTTGTTTGAGCTGTAGGAATTACAGCATTATTATTATTACTTTCACTACCAGTTTTAGCAGGAGCTATTACCATATTATTAACTGATCGAAATTTAAATACTT CATTTTTTGATCCAGCTGGGGGAGGAGATCCAATTTTATACCAACATTTATTT</p> |
| title | Telegonus chiriquensis Staudinger 1875 |
| topic | Biodiversity Taxonomy Animalia Arthropoda Insecta Lepidoptera Hesperiidae Telegonus Telegonus chiriquensis |
| url | https://doi.org/10.5281/zenodo.16804283 |