Pantelleria saittana Tedersoo 2025, sp. nov.

Fuente: Zenodo
Saved in:
Bibliographic Details
Main Authors: Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik
Format: Recurso digital
Published: Zenodo 2025
Subjects:
Online Access:
Tags: Add Tag
No Tags, Be the first to tag this record!
_version_ 1866901575805435904
author Tedersoo, Leho
Hosseyni Moghadam, Mahdieh S.
Panksep, Kristel
Prins, Victoria
Anslan, Sten
Mikryukov, Vladimir
Bahram, Mohammad
Abarenkov, Kessy
Kõljalg, Urmas
Esmaeilzadeh-Salestani, Keyvan
Pawłowska, Julia
Wurzbacher, Christian
Ding, Yi
Alkahtani, Saad Hussin
Nilsson, R. Henrik
author_facet Tedersoo, Leho
Hosseyni Moghadam, Mahdieh S.
Panksep, Kristel
Prins, Victoria
Anslan, Sten
Mikryukov, Vladimir
Bahram, Mohammad
Abarenkov, Kessy
Kõljalg, Urmas
Esmaeilzadeh-Salestani, Keyvan
Pawłowska, Julia
Wurzbacher, Christian
Ding, Yi
Alkahtani, Saad Hussin
Nilsson, R. Henrik
contents <p><i>Pantelleria saittana</i> Tedersoo sp. nov.</p><p><b>Diagnosis.</b></p><p>Separation from other species of <i>Pantelleria</i> based on ITS 2 (positions 131–155 tttacatctttttctaaacttaatc; one mismatch allowed) and LSU D 2 (positions 722–741 aagagtgatggtgatcaagt; one mismatch allowed) as indicated in Fig. 3. Intraspecific variation up to 3.8 % in ITS 2 and up to 1.5 % in LSU. Interspecific distance at least 10.1 % in ITS 2.</p><p><b>Type.</b></p><p>Vouchered soil sample TUE 000518 (<b>holotype</b>); eDNA sequence EUK 1200019 = OZ 253786 (<b>legitype</b>); eDNA sample TUE 100518 (<b>nucleotype</b>); GSMc plot G 3487, <i>Quercus ilex</i> forest soil in Ponta Spadillo, <i>Pantelleria</i>, Italy, 36.8185°N, 12.0149°E.</p><p><b>Description.</b></p><p>Other sequences: OW 839340 and OW 840352 (unspecified soil in Tianshan Mountains, Uyghur Autonomous Region, China); EUK 1138064 (GSMc plot G 4627, mixed forest soil in Tudusoo, Estonia, 59.11368°N, 26.75944°E); EUK 1120811 (GSMc plot S 281, <i>Quercus robur</i> alley soil in Tartu, Estonia, 58.379°N, 26.706°E); EUK 0348125 (urban park soil in Niort, France, 46.325, – 0.4672°E); MH 625427 (microcosm soil in New Zealand); and MF 484888 (unspecified soil in Great Britain).</p><p><b>Etymology.</b></p><p><i>> Pantelleria</i> (Maltese) refers to the type locality, and <i>Saitta</i> (Sicilian) refers to <i>Alessandro Saitta</i>, who collected material from the type locality.</p><p><b>Notes.</b></p><p>Found in soil samples and occasionally in oceanic sediments in temperate and subtropical regions worldwide (n = 18 records). The 86 GlobalFungi records confirm global soil distribution.</p>
format Recurso digital
id zenodo_https___doi_org_10_5281_zenodo_17398716
institution Zenodo
language
publishDate 2025
publisher Zenodo
record_format zenodo
spellingShingle Pantelleria saittana Tedersoo 2025, sp. nov.
Tedersoo, Leho
Hosseyni Moghadam, Mahdieh S.
Panksep, Kristel
Prins, Victoria
Anslan, Sten
Mikryukov, Vladimir
Bahram, Mohammad
Abarenkov, Kessy
Kõljalg, Urmas
Esmaeilzadeh-Salestani, Keyvan
Pawłowska, Julia
Wurzbacher, Christian
Ding, Yi
Alkahtani, Saad Hussin
Nilsson, R. Henrik
Biodiversity
Taxonomy
Fungi
Aphelidiomycota
Pantelleriomycetes
Pantelleriales
Pantelleriaceae
Pantelleria
Pantelleria saittana
<p><i>Pantelleria saittana</i> Tedersoo sp. nov.</p><p><b>Diagnosis.</b></p><p>Separation from other species of <i>Pantelleria</i> based on ITS 2 (positions 131–155 tttacatctttttctaaacttaatc; one mismatch allowed) and LSU D 2 (positions 722–741 aagagtgatggtgatcaagt; one mismatch allowed) as indicated in Fig. 3. Intraspecific variation up to 3.8 % in ITS 2 and up to 1.5 % in LSU. Interspecific distance at least 10.1 % in ITS 2.</p><p><b>Type.</b></p><p>Vouchered soil sample TUE 000518 (<b>holotype</b>); eDNA sequence EUK 1200019 = OZ 253786 (<b>legitype</b>); eDNA sample TUE 100518 (<b>nucleotype</b>); GSMc plot G 3487, <i>Quercus ilex</i> forest soil in Ponta Spadillo, <i>Pantelleria</i>, Italy, 36.8185°N, 12.0149°E.</p><p><b>Description.</b></p><p>Other sequences: OW 839340 and OW 840352 (unspecified soil in Tianshan Mountains, Uyghur Autonomous Region, China); EUK 1138064 (GSMc plot G 4627, mixed forest soil in Tudusoo, Estonia, 59.11368°N, 26.75944°E); EUK 1120811 (GSMc plot S 281, <i>Quercus robur</i> alley soil in Tartu, Estonia, 58.379°N, 26.706°E); EUK 0348125 (urban park soil in Niort, France, 46.325, – 0.4672°E); MH 625427 (microcosm soil in New Zealand); and MF 484888 (unspecified soil in Great Britain).</p><p><b>Etymology.</b></p><p><i>> Pantelleria</i> (Maltese) refers to the type locality, and <i>Saitta</i> (Sicilian) refers to <i>Alessandro Saitta</i>, who collected material from the type locality.</p><p><b>Notes.</b></p><p>Found in soil samples and occasionally in oceanic sediments in temperate and subtropical regions worldwide (n = 18 records). The 86 GlobalFungi records confirm global soil distribution.</p>
title Pantelleria saittana Tedersoo 2025, sp. nov.
topic Biodiversity
Taxonomy
Fungi
Aphelidiomycota
Pantelleriomycetes
Pantelleriales
Pantelleriaceae
Pantelleria
Pantelleria saittana
url https://doi.org/10.5281/zenodo.17398716