| _version_ | 1866901575805435904 |
|---|---|
| author | Tedersoo, Leho Hosseyni Moghadam, Mahdieh S. Panksep, Kristel Prins, Victoria Anslan, Sten Mikryukov, Vladimir Bahram, Mohammad Abarenkov, Kessy Kõljalg, Urmas Esmaeilzadeh-Salestani, Keyvan Pawłowska, Julia Wurzbacher, Christian Ding, Yi Alkahtani, Saad Hussin Nilsson, R. Henrik |
| author_facet | Tedersoo, Leho Hosseyni Moghadam, Mahdieh S. Panksep, Kristel Prins, Victoria Anslan, Sten Mikryukov, Vladimir Bahram, Mohammad Abarenkov, Kessy Kõljalg, Urmas Esmaeilzadeh-Salestani, Keyvan Pawłowska, Julia Wurzbacher, Christian Ding, Yi Alkahtani, Saad Hussin Nilsson, R. Henrik |
| contents | <p><i>Pantelleria saittana</i> Tedersoo sp. nov.</p><p><b>Diagnosis.</b></p><p>Separation from other species of <i>Pantelleria</i> based on ITS 2 (positions 131–155 tttacatctttttctaaacttaatc; one mismatch allowed) and LSU D 2 (positions 722–741 aagagtgatggtgatcaagt; one mismatch allowed) as indicated in Fig. 3. Intraspecific variation up to 3.8 % in ITS 2 and up to 1.5 % in LSU. Interspecific distance at least 10.1 % in ITS 2.</p><p><b>Type.</b></p><p>Vouchered soil sample TUE 000518 (<b>holotype</b>); eDNA sequence EUK 1200019 = OZ 253786 (<b>legitype</b>); eDNA sample TUE 100518 (<b>nucleotype</b>); GSMc plot G 3487, <i>Quercus ilex</i> forest soil in Ponta Spadillo, <i>Pantelleria</i>, Italy, 36.8185°N, 12.0149°E.</p><p><b>Description.</b></p><p>Other sequences: OW 839340 and OW 840352 (unspecified soil in Tianshan Mountains, Uyghur Autonomous Region, China); EUK 1138064 (GSMc plot G 4627, mixed forest soil in Tudusoo, Estonia, 59.11368°N, 26.75944°E); EUK 1120811 (GSMc plot S 281, <i>Quercus robur</i> alley soil in Tartu, Estonia, 58.379°N, 26.706°E); EUK 0348125 (urban park soil in Niort, France, 46.325, – 0.4672°E); MH 625427 (microcosm soil in New Zealand); and MF 484888 (unspecified soil in Great Britain).</p><p><b>Etymology.</b></p><p><i>> Pantelleria</i> (Maltese) refers to the type locality, and <i>Saitta</i> (Sicilian) refers to <i>Alessandro Saitta</i>, who collected material from the type locality.</p><p><b>Notes.</b></p><p>Found in soil samples and occasionally in oceanic sediments in temperate and subtropical regions worldwide (n = 18 records). The 86 GlobalFungi records confirm global soil distribution.</p> |
| format | Recurso digital |
| id | zenodo_https___doi_org_10_5281_zenodo_17398716 |
| institution | Zenodo |
| language | |
| publishDate | 2025 |
| publisher | Zenodo |
| record_format | zenodo |
| spellingShingle | Pantelleria saittana Tedersoo 2025, sp. nov. Tedersoo, Leho Hosseyni Moghadam, Mahdieh S. Panksep, Kristel Prins, Victoria Anslan, Sten Mikryukov, Vladimir Bahram, Mohammad Abarenkov, Kessy Kõljalg, Urmas Esmaeilzadeh-Salestani, Keyvan Pawłowska, Julia Wurzbacher, Christian Ding, Yi Alkahtani, Saad Hussin Nilsson, R. Henrik Biodiversity Taxonomy Fungi Aphelidiomycota Pantelleriomycetes Pantelleriales Pantelleriaceae Pantelleria Pantelleria saittana <p><i>Pantelleria saittana</i> Tedersoo sp. nov.</p><p><b>Diagnosis.</b></p><p>Separation from other species of <i>Pantelleria</i> based on ITS 2 (positions 131–155 tttacatctttttctaaacttaatc; one mismatch allowed) and LSU D 2 (positions 722–741 aagagtgatggtgatcaagt; one mismatch allowed) as indicated in Fig. 3. Intraspecific variation up to 3.8 % in ITS 2 and up to 1.5 % in LSU. Interspecific distance at least 10.1 % in ITS 2.</p><p><b>Type.</b></p><p>Vouchered soil sample TUE 000518 (<b>holotype</b>); eDNA sequence EUK 1200019 = OZ 253786 (<b>legitype</b>); eDNA sample TUE 100518 (<b>nucleotype</b>); GSMc plot G 3487, <i>Quercus ilex</i> forest soil in Ponta Spadillo, <i>Pantelleria</i>, Italy, 36.8185°N, 12.0149°E.</p><p><b>Description.</b></p><p>Other sequences: OW 839340 and OW 840352 (unspecified soil in Tianshan Mountains, Uyghur Autonomous Region, China); EUK 1138064 (GSMc plot G 4627, mixed forest soil in Tudusoo, Estonia, 59.11368°N, 26.75944°E); EUK 1120811 (GSMc plot S 281, <i>Quercus robur</i> alley soil in Tartu, Estonia, 58.379°N, 26.706°E); EUK 0348125 (urban park soil in Niort, France, 46.325, – 0.4672°E); MH 625427 (microcosm soil in New Zealand); and MF 484888 (unspecified soil in Great Britain).</p><p><b>Etymology.</b></p><p><i>> Pantelleria</i> (Maltese) refers to the type locality, and <i>Saitta</i> (Sicilian) refers to <i>Alessandro Saitta</i>, who collected material from the type locality.</p><p><b>Notes.</b></p><p>Found in soil samples and occasionally in oceanic sediments in temperate and subtropical regions worldwide (n = 18 records). The 86 GlobalFungi records confirm global soil distribution.</p> |
| title | Pantelleria saittana Tedersoo 2025, sp. nov. |
| topic | Biodiversity Taxonomy Fungi Aphelidiomycota Pantelleriomycetes Pantelleriales Pantelleriaceae Pantelleria Pantelleria saittana |
| url | https://doi.org/10.5281/zenodo.17398716 |