Tropicochytrium Tedersoo 2025, gen. nov.
Fuente:
Zenodo
Gespeichert in:
| Hauptverfasser: | , , , , , , , , , , , , , , |
|---|---|
| Format: | Recurso digital |
| Veröffentlicht: |
Zenodo
2025
|
| Schlagworte: | |
| Online-Zugang: | |
| Tags: |
Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
|
| _version_ | 1866902113318076416 |
|---|---|
| author | Tedersoo, Leho Hosseyni Moghadam, Mahdieh S. Panksep, Kristel Prins, Victoria Anslan, Sten Mikryukov, Vladimir Bahram, Mohammad Abarenkov, Kessy Kõljalg, Urmas Esmaeilzadeh-Salestani, Keyvan Pawłowska, Julia Wurzbacher, Christian Ding, Yi Alkahtani, Saad Hussin Nilsson, R. Henrik |
| author_facet | Tedersoo, Leho Hosseyni Moghadam, Mahdieh S. Panksep, Kristel Prins, Victoria Anslan, Sten Mikryukov, Vladimir Bahram, Mohammad Abarenkov, Kessy Kõljalg, Urmas Esmaeilzadeh-Salestani, Keyvan Pawłowska, Julia Wurzbacher, Christian Ding, Yi Alkahtani, Saad Hussin Nilsson, R. Henrik |
| contents | <p><i>Tropicochytrium</i> Tedersoo gen. nov.</p><p><b>Type species.</b></p><p><i>Tropicochytrium toronegroense</i> Tedersoo.</p><p><b>Diagnosis.</b></p><p>Distinguishable from other fungi based on diagnostic nucleotide signature in ITS 2 (positions 108–127 in type species ctcgtggtccgcaaggcttt; one mismatch allowed) and LSU D 2 (positions 557–577 in type species and 549–569 in <i>S. cerevisiae</i> agtttatagcctccggtcctg; one mismatch allowed). Forms a monophyletic, least inclusive clade in Tropicochytriaceae, covering sequences EUK 1186758, EUK 0519487, and EUK 1186756 (Figs 1, 12).</p><p><b>Notes.</b></p><p>Recognized based on eDNA sequences only. Comprises potentially 20–25 species represented by sequences EUK 0519487 (forest soil in the Philippines), EUK 1186758 (forest soil in Guadeloupe), EUK 1186753 (forest soil in Puerto Rico), and EUK 0131338 (grassland soil in Colombia).</p> |
| format | Recurso digital |
| id | zenodo_https___doi_org_10_5281_zenodo_17398766 |
| institution | Zenodo |
| language | |
| publishDate | 2025 |
| publisher | Zenodo |
| record_format | zenodo |
| spellingShingle | Tropicochytrium Tedersoo 2025, gen. nov. Tedersoo, Leho Hosseyni Moghadam, Mahdieh S. Panksep, Kristel Prins, Victoria Anslan, Sten Mikryukov, Vladimir Bahram, Mohammad Abarenkov, Kessy Kõljalg, Urmas Esmaeilzadeh-Salestani, Keyvan Pawłowska, Julia Wurzbacher, Christian Ding, Yi Alkahtani, Saad Hussin Nilsson, R. Henrik Biodiversity Taxonomy Fungi Chytridiomycota Tropicochytriomycetes Tropicochytriales Tropicochytriaceae Tropicochytrium <p><i>Tropicochytrium</i> Tedersoo gen. nov.</p><p><b>Type species.</b></p><p><i>Tropicochytrium toronegroense</i> Tedersoo.</p><p><b>Diagnosis.</b></p><p>Distinguishable from other fungi based on diagnostic nucleotide signature in ITS 2 (positions 108–127 in type species ctcgtggtccgcaaggcttt; one mismatch allowed) and LSU D 2 (positions 557–577 in type species and 549–569 in <i>S. cerevisiae</i> agtttatagcctccggtcctg; one mismatch allowed). Forms a monophyletic, least inclusive clade in Tropicochytriaceae, covering sequences EUK 1186758, EUK 0519487, and EUK 1186756 (Figs 1, 12).</p><p><b>Notes.</b></p><p>Recognized based on eDNA sequences only. Comprises potentially 20–25 species represented by sequences EUK 0519487 (forest soil in the Philippines), EUK 1186758 (forest soil in Guadeloupe), EUK 1186753 (forest soil in Puerto Rico), and EUK 0131338 (grassland soil in Colombia).</p> |
| title | Tropicochytrium Tedersoo 2025, gen. nov. |
| topic | Biodiversity Taxonomy Fungi Chytridiomycota Tropicochytriomycetes Tropicochytriales Tropicochytriaceae Tropicochytrium |
| url | https://doi.org/10.5281/zenodo.17398766 |