Sumavosporidium sylvestre Tedersoo & Esmaeilzadeh-Salestani 2025, sp. nov.
Fuente:
Zenodo
Gespeichert in:
| Hauptverfasser: | , , , , , , , , , , , , , , |
|---|---|
| Format: | Recurso digital |
| Veröffentlicht: |
Zenodo
2025
|
| Schlagworte: | |
| Online-Zugang: | |
| Tags: |
Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
|
| _version_ | 1866902193568743424 |
|---|---|
| author | Tedersoo, Leho Hosseyni Moghadam, Mahdieh S. Panksep, Kristel Prins, Victoria Anslan, Sten Mikryukov, Vladimir Bahram, Mohammad Abarenkov, Kessy Kõljalg, Urmas Esmaeilzadeh-Salestani, Keyvan Pawłowska, Julia Wurzbacher, Christian Ding, Yi Alkahtani, Saad Hussin Nilsson, R. Henrik |
| author_facet | Tedersoo, Leho Hosseyni Moghadam, Mahdieh S. Panksep, Kristel Prins, Victoria Anslan, Sten Mikryukov, Vladimir Bahram, Mohammad Abarenkov, Kessy Kõljalg, Urmas Esmaeilzadeh-Salestani, Keyvan Pawłowska, Julia Wurzbacher, Christian Ding, Yi Alkahtani, Saad Hussin Nilsson, R. Henrik |
| contents | <p><i>Sumavosporidium sylvestre</i> Tedersoo & Esmaeilzadeh-Salestani sp. nov.</p><p><b>Diagnosis.</b></p><p>Separation from other species of <i>Sumavosporidium</i> based on ITS 2 (positions 7–31 gaatgaagatgtgatcgaactgtgc; one mismatch allowed) and LSU (positions 465–484 caactagttggccttcaggt; one mismatch allowed) as indicated in Fig. 46. Intraspecific variation up to 2.0 % in ITS 2 and up to 0.2 % in LSU. Interspecific distance at least 12.0 % in ITS 2.</p><p><b>Type.</b></p><p>Vouchered soil sample TUE 000381 (<b>holotype</b>); eDNA sequence UDB 029033 = OZ 253808 (<b>legitype</b>); eDNA sample TUE 100381 (<b>nucleotype</b>); GSMc plot S 114, <i>Picea abies</i> dominated forest soil in <i>Šumava</i>, Czechia, 49.017°N, 13.4751°E.</p><p><b>Description.</b></p><p>Other sequences: UDB 014611 and EUK 0482169 (type locality); UDB 029027, UDB 029028 and UDB 014612 (GSMc plot S 121, <i>Fagus sylvatica</i> forest soil in Taunus, Germany, 50.1413°N, 8.2677°E); EUK 0482019 and EUK 0520242 (GSMc plot S 426, <i>Fagus sylvatica</i> forest soil in Kistrupvang, Denmark, 56.0264°N, 12.3364°E); HQ 022097 (mixed forest soil in Bartlett Experimental Forest, NH, USA, 44.06, – 71.30); EUK 0522425 and EUK 0522433 and (GSMc plot G 4145, mixed deciduous forest soil in Promised Land, PA, USA, 41.30491, – 75.2021°E); EUK 0523233 (GSMc plot S 878, <i>Alnus alnobetula</i> tundra soil in Anadyr, Chukotka, Russia, 64.7219°N, 177.4238°E); EUK 0034322 (GSMc plot G 4713, <i>Tsuga mertensiana</i> forest soil in Crater Lake, OR, USA, 42.9786, – 122.13); and EUK 0521849 (GSMc plot S 892, forest tundra soil in Arman, Magadan, Russia, 59.6972°N, 150.4118°E).</p><p><b>Etymology.</b></p><p><i>Šumava</i> (Czech) refers to the type locality, and <i>sylva</i> (Latin) refers to the forest habitat.</p><p><b>Notes.</b></p><p>Found in eight localities in acidic temperate and boreal forest and tundra soils in Europe, Asia, and North America. GlobalFungi reveals seven additional records from forest soil in Europe and one record from an Indonesian oil palm plantation soil.</p> |
| format | Recurso digital |
| id | zenodo_https___doi_org_10_5281_zenodo_17398970 |
| institution | Zenodo |
| language | |
| publishDate | 2025 |
| publisher | Zenodo |
| record_format | zenodo |
| spellingShingle | Sumavosporidium sylvestre Tedersoo & Esmaeilzadeh-Salestani 2025, sp. nov. Tedersoo, Leho Hosseyni Moghadam, Mahdieh S. Panksep, Kristel Prins, Victoria Anslan, Sten Mikryukov, Vladimir Bahram, Mohammad Abarenkov, Kessy Kõljalg, Urmas Esmaeilzadeh-Salestani, Keyvan Pawłowska, Julia Wurzbacher, Christian Ding, Yi Alkahtani, Saad Hussin Nilsson, R. Henrik Biodiversity Taxonomy Fungi Rozellomycota Sumavosporidiomycetes Sumavosporidiales Sumavosporidiaceae Sumavosporidium Sumavosporidium sylvestre <p><i>Sumavosporidium sylvestre</i> Tedersoo & Esmaeilzadeh-Salestani sp. nov.</p><p><b>Diagnosis.</b></p><p>Separation from other species of <i>Sumavosporidium</i> based on ITS 2 (positions 7–31 gaatgaagatgtgatcgaactgtgc; one mismatch allowed) and LSU (positions 465–484 caactagttggccttcaggt; one mismatch allowed) as indicated in Fig. 46. Intraspecific variation up to 2.0 % in ITS 2 and up to 0.2 % in LSU. Interspecific distance at least 12.0 % in ITS 2.</p><p><b>Type.</b></p><p>Vouchered soil sample TUE 000381 (<b>holotype</b>); eDNA sequence UDB 029033 = OZ 253808 (<b>legitype</b>); eDNA sample TUE 100381 (<b>nucleotype</b>); GSMc plot S 114, <i>Picea abies</i> dominated forest soil in <i>Šumava</i>, Czechia, 49.017°N, 13.4751°E.</p><p><b>Description.</b></p><p>Other sequences: UDB 014611 and EUK 0482169 (type locality); UDB 029027, UDB 029028 and UDB 014612 (GSMc plot S 121, <i>Fagus sylvatica</i> forest soil in Taunus, Germany, 50.1413°N, 8.2677°E); EUK 0482019 and EUK 0520242 (GSMc plot S 426, <i>Fagus sylvatica</i> forest soil in Kistrupvang, Denmark, 56.0264°N, 12.3364°E); HQ 022097 (mixed forest soil in Bartlett Experimental Forest, NH, USA, 44.06, – 71.30); EUK 0522425 and EUK 0522433 and (GSMc plot G 4145, mixed deciduous forest soil in Promised Land, PA, USA, 41.30491, – 75.2021°E); EUK 0523233 (GSMc plot S 878, <i>Alnus alnobetula</i> tundra soil in Anadyr, Chukotka, Russia, 64.7219°N, 177.4238°E); EUK 0034322 (GSMc plot G 4713, <i>Tsuga mertensiana</i> forest soil in Crater Lake, OR, USA, 42.9786, – 122.13); and EUK 0521849 (GSMc plot S 892, forest tundra soil in Arman, Magadan, Russia, 59.6972°N, 150.4118°E).</p><p><b>Etymology.</b></p><p><i>Šumava</i> (Czech) refers to the type locality, and <i>sylva</i> (Latin) refers to the forest habitat.</p><p><b>Notes.</b></p><p>Found in eight localities in acidic temperate and boreal forest and tundra soils in Europe, Asia, and North America. GlobalFungi reveals seven additional records from forest soil in Europe and one record from an Indonesian oil palm plantation soil.</p> |
| title | Sumavosporidium sylvestre Tedersoo & Esmaeilzadeh-Salestani 2025, sp. nov. |
| topic | Biodiversity Taxonomy Fungi Rozellomycota Sumavosporidiomycetes Sumavosporidiales Sumavosporidiaceae Sumavosporidium Sumavosporidium sylvestre |
| url | https://doi.org/10.5281/zenodo.17398970 |