Saved in:
Bibliographic Details
Main Authors: Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik
Format: Recurso digital
Language:
Published: Zenodo 2025
Subjects:
Online Access:https://doi.org/10.5281/zenodo.17398989
Tags: Add Tag
No Tags, Be the first to tag this record!
Table of Contents:
  • <p><i>Aldinomyces</i> Tedersoo gen. nov.</p><p><b>Type species.</b></p><p><i>Aldinomyces tarquinii</i> Tedersoo.</p><p><b>Diagnosis.</b></p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in ITS 2 (positions 139–158 gcggatttcgaaagatttct in type species; one mismatch allowed). Forms a monophyletic, least inclusive clade in Aldinomycetaceae, covering sequences EUK 1205365, EUK 1124394, and EUK 0529911 (Figs 1, 49).</p><p><b>Notes.</b></p><p>Recognized based on eDNA sequences only. Comprises about four potential species represented by sequences EUK 0483667 (forest soil in Argentina), EUK 0138900 (forest soil in Norway), and EUK 0529911 (<i>woodland</i> soil in Estonia).</p>