Saved in:
| Main Authors: | , , , , , , , , , , , , , , |
|---|---|
| Format: | Recurso digital |
| Language: | |
| Published: |
Zenodo
2025
|
| Subjects: | |
| Online Access: | https://doi.org/10.5281/zenodo.17398989 |
| Tags: |
Add Tag
No Tags, Be the first to tag this record!
|
Table of Contents:
- <p><i>Aldinomyces</i> Tedersoo gen. nov.</p><p><b>Type species.</b></p><p><i>Aldinomyces tarquinii</i> Tedersoo.</p><p><b>Diagnosis.</b></p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in ITS 2 (positions 139–158 gcggatttcgaaagatttct in type species; one mismatch allowed). Forms a monophyletic, least inclusive clade in Aldinomycetaceae, covering sequences EUK 1205365, EUK 1124394, and EUK 0529911 (Figs 1, 49).</p><p><b>Notes.</b></p><p>Recognized based on eDNA sequences only. Comprises about four potential species represented by sequences EUK 0483667 (forest soil in Argentina), EUK 0138900 (forest soil in Norway), and EUK 0529911 (<i>woodland</i> soil in Estonia).</p>