Saved in:
| Main Authors: | , , , , , , , , , , , , , , |
|---|---|
| Format: | Recurso digital |
| Language: | |
| Published: |
Zenodo
2025
|
| Subjects: | |
| Online Access: | https://doi.org/10.5281/zenodo.17399019 |
| Tags: |
Add Tag
No Tags, Be the first to tag this record!
|
Table of Contents:
- <p><i>Mirabilomyces abrukanus</i> Tedersoo & R. H. Nilsson sp. nov.</p><p><b>Diagnosis.</b></p><p>Separation from other species of <i>Mirabilomyces</i> based on ITS 2 (positions 68–87 cttcggttwtaaaacaaggt; two mismatches allowed) and LSU (positions 534–553 ctacgctgtggttgcgcttt; one mismatch allowed) as indicated in Fig. 54. Intraspecific variation up to 11.4 % in ITS 2 due to length polymorphism in multiple mono- and dinucleotide repeats and up to 1.0 % in LSU. Interspecific distance> 20 % in ITS 2 and at least 6.0 % in LSU.</p><p><b>Type.</b></p><p>Vouchered soil sample TUE 000464 (<b>holotype</b>); eDNA sequence EUK 1200676 = OZ 253813 (<b>legitype</b>); eDNA sample TUE 100464 (<b>nucleotype</b>); GSMc plot S 208, <i>Tilia cordata</i> temperate forest soil in Abruka, Estonia, 58.1568°N, 22.5004°E.</p><p><b>Description.</b></p><p>Other sequences: EUK 0483305 (temperate broadleaf forest soil in Arcais, France, 46.3038, – 0.6844°E); EUK 1124377 (GSMc plot G 5235, <i>Larix decidua</i> plantation soil in Rõõmu, Estonia, 58.3835°N, 26.7742°E); EUK 1216948 (GSMc plot G 4777, flooded grassland soil in Suur-Pakri Härs-hämani, Estonia, 59.3310°N, 23.9272°E); EUK 1216949 (GSMc plot G 4679, <i>Salix triandra</i> wetland soil in Prangli Rivimaa, Estonia, 59.6150°N, 24.9871°E); OU 939561 (grassland soil in Kungsängen, Sweden, 59.837°N, 17.661°E); EUK 1202060 (GSMc plot G 4747, <i>Prunus-Rhamnus-Euonymus</i> forest soil in Tsirgumäe, Estonia, 57.5942°N, 26.3241°E); EUK 1216950 (GSMc plot G 4742, <i>Fraxinus-Ulmus</i> forest soil in Lüütre, Estonia, 58.1444°N, 25.2628°E); and EUK 1216946 (GSMc plot S 1366, temperate grassland soil in Innhavet, Norway, 67.9676°N, 15.9277°E).</p><p><b>Etymology.</b></p><p><i>Mirabilis</i> (Latin) refers to the remarkable and astonishing finding of a large, unrecognized fungal lineage, and <i>Abruka</i> (Estonian) refers to the type locality of the species.</p><p><b>Notes.</b></p><p>Found in grassland and forest soils in North and Central Europe (n = 57 records), with single records from Asia, North America, and Africa. GlobalFungi reveals no additional information.</p>