Leptopilina fimbriata
Fuente:
Zenodo
Salvato in:
| Autori principali: | , , , , , , , , |
|---|---|
| Natura: | Recurso digital |
| Pubblicazione: |
Zenodo
2025
|
| Soggetti: | |
| Accesso online: | |
| Tags: |
Aggiungi Tag
Nessun Tag, puoi essere il primo ad aggiungerne!!
|
| _version_ | 1866901515171528704 |
|---|---|
| author | Vogel, Jonathan Martin, Jakob Forshage, Mattias Salden, Tobias Staverløkk, Arnstein Verheyde, Fons Nordlander, Göran Herz, Annette Peters, Ralph S. |
| author_facet | Vogel, Jonathan Martin, Jakob Forshage, Mattias Salden, Tobias Staverløkk, Arnstein Verheyde, Fons Nordlander, Göran Herz, Annette Peters, Ralph S. |
| contents | <p><i>Leptopilina fimbriata</i> (Kieffer, 1901)</p><p><i>Erisphagia longipes</i> Cameron, 1883: 371.</p><p><i>Eucoela</i> (<i>Eucoela</i>) <i>fimbriata</i> Kieffer, 1901: 174.</p><p><i>Psilosema</i> (<i>Erisphagia</i>) <i>xanthopum</i> Kieffer, 1904: 605.</p><p><i>Psilosema</i> (<i>Erisphagia</i>) <i>filicorne</i> Kieffer, 1904: 606–607.</p><p><i>Psilosema longicornis</i> Kieffer, 1907: 619.</p><p><i>Episoda dolichocera</i> Hellén, 1960: 19–20.</p><p><b>Diagnosis.</b></p><p><i>Leptopilina fimbriata</i> is a small to medium-sized species (up to 1.6 mm ♀ body length) with slender appearance and remarkably long and filiform antennae in both sexes reaching more than 1.0 times the body length in females and more than 1.9 times the body length in males (Fig. 5 A). The metasoma is significantly paler than head and mesosoma, a pattern similar as in <i>L. longipes</i>, but more distinct. Also, the legs are strikingly stramineous (Fig. 5 A), while they are generally darker (brownish to reddish) in all other species.</p><p>Additionally, the mesoscutellar plate is usually notably circular and short in dorsal view (Fig. 5 C), and elevated and strongly sloping posteriorly in lateral view (Fig. 5 A). Other species possess either a rhombic (<i>L. heterotoma</i>) or drop-shaped (all other species), not notably short or elevated mesoscutellar plate, only slightly sloping posteriorly in <i>L. longipes</i>.</p><p>The metapleural ridge 1 is shorter than half the length of the metapleuron (Fig. 5 D) as in <i>L. australis</i> and <i>L. clavipes</i>. In other species, ridge 1 is at least half as long as the metapleuron, if present at all. The metapleural ridge 2 is shorter than half the length of the metapleuron (Fig. 5 D), as in <i>L. australis</i>, <i>L. boulardi</i>, and <i>L. clavipes</i>. In other species, ridge 2 is at least half as long as the metapleuron. The forewing is long with a narrow marginal cell. The forewing vein Rs is clearly longer than 2 r, and the accessory veins (M, Rs + M CU 1 and CU 1 a) are usually very distinct (Fig. 12 B), while they are faint or absent in other species.</p><p>Superficially, <i>L. fimbriata</i> is quite similar to <i>Ganaspis seticornis</i> Hellén, 1960. This is another eucoiline species from a genus potentially associated with <i>Drosophila</i> and the most slenderly built European species in that genus. However, these genera are not closely related. <i>Ganaspis</i> is having far more of a hairy ring, less of a petiolar rim, a long row of setae on the metacoxae, and modified F 1 instead of F 2 in the male antenna.</p><p><b>Molecular characterisation.</b></p><p>Maximum intraspecific barcode-distance: 1.4 % (37).</p><p>Minimum interspecific barcode-distance: 13.0 % (<i>L. japonica</i>).</p><p>Consensus barcode sequence: 658 bp.</p><p>5 ’ - AGTTATATATTTTATTTTTGGGATTTGATCTGGGATAGTGGGGGCGAGATTGAGGATAATTATTCGTATAGAATTGGGGATACCGGGGCAGTTAATTAATAATGATCAAGTTTATAATACTATTGTTACGGCTCATGCATTTATTATAATTTTTTTTATAGTGATACCTATTATAGTTGGTGGGTTTGGGAACTATTTAATTCCTTTAATAATTACAGTTCCTGATATGGCGTTTCCTCGATTAAATAATATAAGATTATGACTTTTATTTCCTTCTTTATTTTTAATGTTAGCTAGAATATTTATTGATCAGGGGGCCGGGACAGGATGAACTGTTTATCCCCCTTTATCTTTAAGAATTGGGCATCCGGGGGTTTCTGTTGATTTAGTGATTTTTTCGTTACATTTAAGGGGGGTTTCTTCTATTTTGGGGTCAATTAATTTTATTTCTACTATTTTAAATGTTCGTCCAAATTTAATAATAATGGATAAAGTTACTTTATTTATTTGGTCTATTTTTTTAACAACTATTTTATTACTGTTATCTTTACCGGTATTAGCTGGGGGGATTACAATATTATTATTTGATCGTAATTTAAATACTTCTTTTTATGATCCTGTGGGAGGGGGGGATCCAATTTTGTATCAACATTTATTT- 3 ’.</p><p><b>Biology.</b></p><p><b><i>Habitat</i>.</b> Occurs in open and forested sites, as long as there is a layer of leaf litter, but preferrably in structure- and nutrient-rich and more or less damp habitats (e. g. lush garden, alluvial forest, spruce forest, beech forest, young aspen forest, open oak forest, abandoned meadow, shrubby meadow, open sandy pine forest, manure heap in open farmland, calcareous fen, reedbed). Emerged from decaying plant matter (e. g. beet leaves) and <i>Heracleum mantegazzianum</i>. Common in Malaise trap and sweep net samples.</p><p><b><i>Flight period</i>.</b> In Europe, from May to late September, but spring records are sparse and there is a peak in July and August. In Macaronesia also occurring throughout winter.</p><p><b><i>Hosts</i>.</b> Specialist which has only been found to parasitise <i>Scaptomyza pallida</i> (van Alphen and Vet 1986, no specifics mentioned on the methodology, but seemingly an <i>in situ</i> observation) and <i>Drosophila subobscura</i> (van Alphen & Vet pers comm. in Carton et al. 1986).</p><p><b>Distribution.</b></p><p>Palearctic species. Present in Austria, Belgium, the Canary Islands, Czech Republic, Denmark, Estonia, Finland (locus typicus of <i>Episoda dolichocera</i>), France (locus typicus of <i>Eucoela fimbriata</i>, <i>Psilosema xanthopum</i>, <i>Psilosema filicorne</i> and <i>Psilosema longicornis</i>), Georgia, Germany, Greece, Italy, Lithuania, Madeira, the Netherlands, Norway, Poland, Portugal, Russia, Slovenia, Spain (locus typicus of <i>Erisphagia longipes</i>), Sweden, Switzerland, Ukraine, and the United Kingdom. Further East, the species was also recorded from Kyrgysztan and China (BOLD). The published record from the Afrotropical region (van Noort et al. 2015) may be a mistake and requires substantiation.</p><p><b>Remarks.</b></p><p>The first available name for this species is <i>Erisphagia longipes</i> Cameron, 1883. However, after moving it to <i>Leptopilina</i>, it became a junior homonym of <i>L. longipes</i> (Hartig, 1841) (Nordlander, 1980). <i>Leptopilina fimbriata</i> (Kieffer, 1901), as the second-oldest name, thereby serves as the valid name.</p><p>We sequenced 37 specimens of <i>L. fimbriata</i> from 11 localities. On BOLD, this species is represented by a single BIN: “ BOLD: ACO 1262 ”. Our <i>CO 1</i> sequences are the first representatives of <i>L. fimbriata</i> in DROP.</p> |
| format | Recurso digital |
| id | zenodo_https___doi_org_10_5281_zenodo_17436390 |
| institution | Zenodo |
| language | |
| publishDate | 2025 |
| publisher | Zenodo |
| record_format | zenodo |
| spellingShingle | Leptopilina fimbriata Vogel, Jonathan Martin, Jakob Forshage, Mattias Salden, Tobias Staverløkk, Arnstein Verheyde, Fons Nordlander, Göran Herz, Annette Peters, Ralph S. Biodiversity Taxonomy Animalia Arthropoda Insecta Hymenoptera Figitidae Leptopilina Leptopilina fimbriata <p><i>Leptopilina fimbriata</i> (Kieffer, 1901)</p><p><i>Erisphagia longipes</i> Cameron, 1883: 371.</p><p><i>Eucoela</i> (<i>Eucoela</i>) <i>fimbriata</i> Kieffer, 1901: 174.</p><p><i>Psilosema</i> (<i>Erisphagia</i>) <i>xanthopum</i> Kieffer, 1904: 605.</p><p><i>Psilosema</i> (<i>Erisphagia</i>) <i>filicorne</i> Kieffer, 1904: 606–607.</p><p><i>Psilosema longicornis</i> Kieffer, 1907: 619.</p><p><i>Episoda dolichocera</i> Hellén, 1960: 19–20.</p><p><b>Diagnosis.</b></p><p><i>Leptopilina fimbriata</i> is a small to medium-sized species (up to 1.6 mm ♀ body length) with slender appearance and remarkably long and filiform antennae in both sexes reaching more than 1.0 times the body length in females and more than 1.9 times the body length in males (Fig. 5 A). The metasoma is significantly paler than head and mesosoma, a pattern similar as in <i>L. longipes</i>, but more distinct. Also, the legs are strikingly stramineous (Fig. 5 A), while they are generally darker (brownish to reddish) in all other species.</p><p>Additionally, the mesoscutellar plate is usually notably circular and short in dorsal view (Fig. 5 C), and elevated and strongly sloping posteriorly in lateral view (Fig. 5 A). Other species possess either a rhombic (<i>L. heterotoma</i>) or drop-shaped (all other species), not notably short or elevated mesoscutellar plate, only slightly sloping posteriorly in <i>L. longipes</i>.</p><p>The metapleural ridge 1 is shorter than half the length of the metapleuron (Fig. 5 D) as in <i>L. australis</i> and <i>L. clavipes</i>. In other species, ridge 1 is at least half as long as the metapleuron, if present at all. The metapleural ridge 2 is shorter than half the length of the metapleuron (Fig. 5 D), as in <i>L. australis</i>, <i>L. boulardi</i>, and <i>L. clavipes</i>. In other species, ridge 2 is at least half as long as the metapleuron. The forewing is long with a narrow marginal cell. The forewing vein Rs is clearly longer than 2 r, and the accessory veins (M, Rs + M CU 1 and CU 1 a) are usually very distinct (Fig. 12 B), while they are faint or absent in other species.</p><p>Superficially, <i>L. fimbriata</i> is quite similar to <i>Ganaspis seticornis</i> Hellén, 1960. This is another eucoiline species from a genus potentially associated with <i>Drosophila</i> and the most slenderly built European species in that genus. However, these genera are not closely related. <i>Ganaspis</i> is having far more of a hairy ring, less of a petiolar rim, a long row of setae on the metacoxae, and modified F 1 instead of F 2 in the male antenna.</p><p><b>Molecular characterisation.</b></p><p>Maximum intraspecific barcode-distance: 1.4 % (37).</p><p>Minimum interspecific barcode-distance: 13.0 % (<i>L. japonica</i>).</p><p>Consensus barcode sequence: 658 bp.</p><p>5 ’ - AGTTATATATTTTATTTTTGGGATTTGATCTGGGATAGTGGGGGCGAGATTGAGGATAATTATTCGTATAGAATTGGGGATACCGGGGCAGTTAATTAATAATGATCAAGTTTATAATACTATTGTTACGGCTCATGCATTTATTATAATTTTTTTTATAGTGATACCTATTATAGTTGGTGGGTTTGGGAACTATTTAATTCCTTTAATAATTACAGTTCCTGATATGGCGTTTCCTCGATTAAATAATATAAGATTATGACTTTTATTTCCTTCTTTATTTTTAATGTTAGCTAGAATATTTATTGATCAGGGGGCCGGGACAGGATGAACTGTTTATCCCCCTTTATCTTTAAGAATTGGGCATCCGGGGGTTTCTGTTGATTTAGTGATTTTTTCGTTACATTTAAGGGGGGTTTCTTCTATTTTGGGGTCAATTAATTTTATTTCTACTATTTTAAATGTTCGTCCAAATTTAATAATAATGGATAAAGTTACTTTATTTATTTGGTCTATTTTTTTAACAACTATTTTATTACTGTTATCTTTACCGGTATTAGCTGGGGGGATTACAATATTATTATTTGATCGTAATTTAAATACTTCTTTTTATGATCCTGTGGGAGGGGGGGATCCAATTTTGTATCAACATTTATTT- 3 ’.</p><p><b>Biology.</b></p><p><b><i>Habitat</i>.</b> Occurs in open and forested sites, as long as there is a layer of leaf litter, but preferrably in structure- and nutrient-rich and more or less damp habitats (e. g. lush garden, alluvial forest, spruce forest, beech forest, young aspen forest, open oak forest, abandoned meadow, shrubby meadow, open sandy pine forest, manure heap in open farmland, calcareous fen, reedbed). Emerged from decaying plant matter (e. g. beet leaves) and <i>Heracleum mantegazzianum</i>. Common in Malaise trap and sweep net samples.</p><p><b><i>Flight period</i>.</b> In Europe, from May to late September, but spring records are sparse and there is a peak in July and August. In Macaronesia also occurring throughout winter.</p><p><b><i>Hosts</i>.</b> Specialist which has only been found to parasitise <i>Scaptomyza pallida</i> (van Alphen and Vet 1986, no specifics mentioned on the methodology, but seemingly an <i>in situ</i> observation) and <i>Drosophila subobscura</i> (van Alphen & Vet pers comm. in Carton et al. 1986).</p><p><b>Distribution.</b></p><p>Palearctic species. Present in Austria, Belgium, the Canary Islands, Czech Republic, Denmark, Estonia, Finland (locus typicus of <i>Episoda dolichocera</i>), France (locus typicus of <i>Eucoela fimbriata</i>, <i>Psilosema xanthopum</i>, <i>Psilosema filicorne</i> and <i>Psilosema longicornis</i>), Georgia, Germany, Greece, Italy, Lithuania, Madeira, the Netherlands, Norway, Poland, Portugal, Russia, Slovenia, Spain (locus typicus of <i>Erisphagia longipes</i>), Sweden, Switzerland, Ukraine, and the United Kingdom. Further East, the species was also recorded from Kyrgysztan and China (BOLD). The published record from the Afrotropical region (van Noort et al. 2015) may be a mistake and requires substantiation.</p><p><b>Remarks.</b></p><p>The first available name for this species is <i>Erisphagia longipes</i> Cameron, 1883. However, after moving it to <i>Leptopilina</i>, it became a junior homonym of <i>L. longipes</i> (Hartig, 1841) (Nordlander, 1980). <i>Leptopilina fimbriata</i> (Kieffer, 1901), as the second-oldest name, thereby serves as the valid name.</p><p>We sequenced 37 specimens of <i>L. fimbriata</i> from 11 localities. On BOLD, this species is represented by a single BIN: “ BOLD: ACO 1262 ”. Our <i>CO 1</i> sequences are the first representatives of <i>L. fimbriata</i> in DROP.</p> |
| title | Leptopilina fimbriata |
| topic | Biodiversity Taxonomy Animalia Arthropoda Insecta Hymenoptera Figitidae Leptopilina Leptopilina fimbriata |
| url | https://doi.org/10.5281/zenodo.17436390 |